Gene Page: TMEM63B
Summary ?
| GeneID | 55362 |
| Symbol | TMEM63B |
| Synonyms | C6orf110 |
| Description | transmembrane protein 63B |
| Reference | HGNC:HGNC:17735|Ensembl:ENSG00000137216|HPRD:16656|Vega:OTTHUMG00000014757 |
| Gene type | protein-coding |
| Map location | 6p21.1 |
| Pascal p-value | 0.003 |
| Sherlock p-value | 0.739 |
| eGene | Cerebellar Hemisphere Cerebellum Meta |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
| Expression | Meta-analysis of gene expression | P value: 2.376 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| MARTORIATI MDM4 TARGETS FETAL LIVER UP | 227 | 137 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-130/301 | 561 | 567 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| miR-145 | 545 | 551 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-148/152 | 562 | 568 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
| hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
| hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
| miR-19 | 560 | 566 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-199 | 543 | 550 | 1A,m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.