Gene Page: SVOP

Summary
GeneID  55530
Symbol  SVOP
Synonyms  DKFZp761H039
Description  SV2 related protein homolog (rat)
See related  HGNC:25417|MIM:611699|Ensembl:ENSG00000166111|HPRD:13224|
Locus tag  -
Gene type  protein-coding
Map location  12q24.11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005215transporter activityIEA-
GO:0015075ion transmembrane transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006811ion transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0008021synaptic vesicleISSSynap, Neurotransmitter (GO term level: 12)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0030054cell junctionIEA-
GO:0031410cytoplasmic vesicleIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-10124130m8hsa-miR-10aUACCCUGUAGAUCCGAAUUUGUG
hsa-miR-10bUACCCUGUAGAACCGAAUUUGU
miR-34/4498086m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.