Gene Page: PLXNA3
Summary ?
| GeneID | 55558 |
| Symbol | PLXNA3 |
| Synonyms | 6.3|HSSEXGENE|PLXN3|PLXN4|XAP-6 |
| Description | plexin A3 |
| Reference | MIM:300022|HGNC:HGNC:9101|HPRD:02062| |
| Gene type | protein-coding |
| Map location | Xq28 |
| Fetal beta | 1.417 |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Ambalavanan_2016 | Whole Exome Sequencing | This dataset includes 20 de novo mutations detected in 17 COS probands. | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| PLXNA3 | chrX | 153692763 | G | A | NM_017514 | p.(Arg616Gln) | nonsynonymous SNV | 0.001 | Childhood-onset schizophrenia | DNM:Ambalavanan_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| GLB1L2 | 0.59 | 0.38 |
| TMPRSS13 | 0.57 | 0.38 |
| KIAA1530 | 0.56 | 0.45 |
| PAPPA2 | 0.56 | 0.32 |
| WNT7B | 0.55 | 0.32 |
| CLCF1 | 0.55 | 0.49 |
| CECR2 | 0.53 | 0.41 |
| RP11-274B21.1 | 0.52 | 0.46 |
| AC010522.1 | 0.52 | 0.45 |
| DUOX1 | 0.52 | 0.42 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| DHRS7 | -0.43 | -0.47 |
| C5orf35 | -0.37 | -0.48 |
| PHYH | -0.36 | -0.37 |
| TMEM22 | -0.36 | -0.45 |
| ACOT13 | -0.36 | -0.40 |
| ITM2B | -0.36 | -0.40 |
| MGST2 | -0.35 | -0.40 |
| PXMP3 | -0.35 | -0.46 |
| ACYP2 | -0.35 | -0.37 |
| HDDC2 | -0.35 | -0.38 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004888 | transmembrane receptor activity | NAS | 8570614 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
| GO:0021860 | pyramidal neuron development | IEA | neuron, Brain (GO term level: 12) | - |
| GO:0048843 | negative regulation of axon extension involved in axon guidance | IEA | axon (GO term level: 16) | - |
| GO:0007165 | signal transduction | IEA | - | |
| GO:0007275 | multicellular organismal development | TAS | 8570614 | |
| GO:0050919 | negative chemotaxis | IEA | - | |
| GO:0021766 | hippocampus development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0016020 | membrane | TAS | 8570614 | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME CRMPS IN SEMA3A SIGNALING | 14 | 14 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMA3A PAK DEPENDENT AXON REPULSION | 15 | 14 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
| REACTOME SEMA3A PLEXIN REPULSION SIGNALING BY INHIBITING INTEGRIN ADHESION | 13 | 9 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
| LOPEZ MESOTELIOMA SURVIVAL TIME UP | 14 | 8 | All SZGR 2.0 genes in this pathway |
| LOPEZ MESOTHELIOMA SURVIVAL WORST VS BEST UP | 14 | 10 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 TTD UP | 64 | 39 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
| DAZARD UV RESPONSE CLUSTER G1 | 67 | 41 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
| SYED ESTRADIOL RESPONSE | 19 | 15 | All SZGR 2.0 genes in this pathway |
| LOPEZ MESOTHELIOMA SURVIVAL OVERALL DN | 16 | 8 | All SZGR 2.0 genes in this pathway |
| LOPEZ MESOTHELIOMA SURVIVAL DN | 12 | 6 | All SZGR 2.0 genes in this pathway |
| WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
| WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| NABA ECM AFFILIATED | 171 | 89 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 811 | 817 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 810 | 817 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-137 | 226 | 232 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.