Gene Page: MAP7D1
Summary ?
| GeneID | 55700 |
| Symbol | MAP7D1 |
| Synonyms | PARCC1|RPRC1 |
| Description | MAP7 domain containing 1 |
| Reference | HGNC:HGNC:25514|Ensembl:ENSG00000116871|HPRD:07666|Vega:OTTHUMG00000007714 |
| Gene type | protein-coding |
| Map location | 1p34.3 |
| Pascal p-value | 4.422E-5 |
| Sherlock p-value | 0.999 |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TRIM39 | 0.96 | 0.95 |
| LSM7 | 0.91 | 0.93 |
| RPL36 | 0.91 | 0.85 |
| RPS15P5 | 0.90 | 0.85 |
| PQBP1 | 0.90 | 0.91 |
| POLR2F | 0.90 | 0.87 |
| RPL28 | 0.90 | 0.83 |
| RPL8 | 0.89 | 0.90 |
| MYL6 | 0.89 | 0.87 |
| MRPS34 | 0.89 | 0.87 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ABCB1 | -0.58 | -0.67 |
| AF347015.27 | -0.57 | -0.72 |
| AF347015.33 | -0.57 | -0.71 |
| AF347015.15 | -0.57 | -0.74 |
| AF347015.26 | -0.56 | -0.76 |
| ABCG2 | -0.56 | -0.63 |
| MT-CYB | -0.56 | -0.72 |
| AF347015.8 | -0.56 | -0.72 |
| EPB41L2 | -0.56 | -0.66 |
| PTPRB | -0.55 | -0.62 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
| UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| BILD HRAS ONCOGENIC SIGNATURE | 261 | 166 | All SZGR 2.0 genes in this pathway |
| HUANG DASATINIB RESISTANCE UP | 81 | 53 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 330 | 336 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-141/200a | 538 | 545 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-144 | 329 | 336 | 1A,m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-18 | 141 | 148 | 1A,m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
| hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
| miR-23 | 323 | 329 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.