Gene Page: POLR3E

Summary
GeneID  55718
Symbol  POLR3E
Synonyms  RPC5|SIN
Description  polymerase (RNA) III (DNA directed) polypeptide E (80kD)
See related  HGNC:30347|Ensembl:ENSG00000058600|HPRD:15155|
Locus tag  -
Gene type  protein-coding
Map location  16p12.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003899DNA-directed RNA polymerase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
POLR3ARPC1 | RPC155 | hRPC155polymerase (RNA) III (DNA directed) polypeptide A, 155kDa-HPRD,BioGRID12391170 
POLR3DBN51T | RPC4 | RPC53 | TSBN51polymerase (RNA) III (DNA directed) polypeptide D, 44kDa-HPRD,BioGRID12391170 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-5041711781A,m8hsa-miR-504AGACCCUGGUCUGCACUCUAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.