|
|
| GeneID |
55835
|
| Symbol |
CENPJ
|
| Synonyms |
BM032|CPAP|LAP|LIP1|MCPH6|MGC131581|MGC131582|MGC142222|MGC142224
|
| Description |
centromere protein J |
| See related |
HGNC:17272|MIM:609279|Ensembl:ENSG00000151849|HPRD:09876| |
| Locus tag |
RP11-756A22.2 |
| Gene type |
protein-coding |
| Map location |
13q12.12 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia] | Click to show detail |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005515 | protein binding | IEA | | - |
| GO:0015631 | tubulin binding | IDA | | 15047868 |
| GO:0019904 | protein domain specific binding | IPI | | 11984006 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0007020 | microtubule nucleation | TAS | | 11003675 |
| GO:0051301 | cell division | NAS | | 11003675 |
| GO:0046785 | microtubule polymerization | IMP | | 15047868 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005813 | centrosome | IEA | | - |
| GO:0005856 | cytoskeleton | IEA | | - |
| GO:0005874 | microtubule | IEA | | - |
| GO:0005737 | cytoplasm | IEA | | - |
| GO:0008275 | gamma-tubulin small complex | NAS | | 11003675 |
| |
|
|
| |
|
| miR-433-3p | 14 | 21 | 1A,m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|