Gene Page: CRTAM

Summary
GeneID  56253
Symbol  CRTAM
Synonyms  -
Description  cytotoxic and regulatory T cell molecule
See related  HGNC:24313|Ensembl:ENSG00000109943|HPRD:16760|
Locus tag  -
Gene type  protein-coding
Map location  11q22-q23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005102receptor bindingIPINeurotransmitter (GO term level: 4)15811952 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0002355detection of tumor cellIDA15811952 
GO:0002860positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell targetIDA15811952 
GO:0001913T cell mediated cytotoxicityIDA15811952 
GO:0008037cell recognitionIDA15811952 
GO:0006955immune responseIEA-
GO:0051606detection of stimulusIDA15811952 
GO:0050715positive regulation of cytokine secretionIDA15811952 
GO:0050798activated T cell proliferationIDA15811952 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIDA15811952 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1331691751Ahsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-142-3p233239m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-539119912061A,m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.