SZGR2

Summary ?

GeneID	56751
Symbol	BARHL1
Synonyms	-
Description	BarH like homeobox 1
Reference	MIM:605211\|HGNC:HGNC:953\|Ensembl:ENSG00000125492\|HPRD:05554\|Vega:OTTHUMG00000020839
Gene type	protein-coding
Map location	9q34
Pascal p-value	0.293
Fetal beta	0.13
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg09771468	9	135462169	BARHL1	2.15E-9	-0.019	1.69E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs3765543	chr9	134458323	BARHL1	56751	0	cis
rs10122864	chr9	134991712	BARHL1	56751	0.15	cis
rs1009138	chr9	135000607	BARHL1	56751	0.09	cis
rs17392743	chr1	54764240	BARHL1	56751	0.02	trans
rs2502827	chr1	176044216	BARHL1	56751	0.02	trans
rs12405921	chr1	206695730	BARHL1	56751	0.15	trans
rs17572651	chr1	218943612	BARHL1	56751	1.42E-4	trans
rs16858054	chr2	171105787	BARHL1	56751	0.08	trans
rs3845734	chr2	171125572	BARHL1	56751	0.01	trans
rs8179648	chr2	179377279	BARHL1	56751	0.06	trans
rs7584986	chr2	184111432	BARHL1	56751	6.967E-7	trans
rs9810143	chr3	5060209	BARHL1	56751	0.19	trans
rs7635430	chr3	180152035	BARHL1	56751	0.05	trans
rs363082	chr4	3132712	BARHL1	56751	0.18	trans
snp_a-1815771		0	BARHL1	56751	0.1	trans
rs335980	chr4	173329784	BARHL1	56751	0.16	trans
rs17762315	chr5	76807576	BARHL1	56751	0.01	trans
rs7729096	chr5	76835927	BARHL1	56751	0.01	trans
rs10491487	chr5	80323367	BARHL1	56751	0.05	trans
rs11738579	chr5	95119841	BARHL1	56751	0.04	trans
rs979348	chr5	97074134	BARHL1	56751	0.15	trans
rs1368303	chr5	147672388	BARHL1	56751	0.09	trans
rs13360496		0	BARHL1	56751	0.07	trans
rs16890367	chr6	38078448	BARHL1	56751	0.11	trans
rs17079498	chr8	3018343	BARHL1	56751	0.03	trans
rs7021724	chr9	2527899	BARHL1	56751	0.13	trans
rs11139334	chr9	84209393	BARHL1	56751	8.044E-7	trans
rs2766987	chr9	113667956	BARHL1	56751	0.01	trans
rs3765543	chr9	134458323	BARHL1	56751	0.14	trans
rs2393316	chr10	59333070	BARHL1	56751	9.394E-4	trans
rs12716680	chr13	42196469	BARHL1	56751	0.1	trans
rs7996604	chr13	42224412	BARHL1	56751	0.04	trans
rs7337967	chr13	53519044	BARHL1	56751	0.14	trans
rs17104720	chr14	77127308	BARHL1	56751	0.15	trans
rs16955618	chr15	29937543	BARHL1	56751	5.892E-31	trans
rs2077735	chr15	58479024	BARHL1	56751	0.04	trans
rs11873184	chr18	1584081	BARHL1	56751	0.09	trans
rs17761686	chr18	56647634	BARHL1	56751	0.07	trans
rs7274477	chr20	1676942	BARHL1	56751	0.05	trans
rs749043	chr20	46995700	BARHL1	56751	0.17	trans
rs1041786	chr21	22617710	BARHL1	56751	2.491E-4	trans
rs16990575	chrX	32691327	BARHL1	56751	0.13	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0005515	protein binding	IPI		17353931
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001764	neuron migration	IEA	neuron (GO term level: 8)	-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0007605	sensory perception of sound	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED	536	296	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3	269	159	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS HCP WITH H3 UNMETHYLATED	80	50	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-363	498	504	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-411	545	551	m8	hsa-miR-411	AACACGGUCCACUAACCCUCAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BARHL1