Gene Page: AGPAT4

Summary
GeneID  56895
Symbol  AGPAT4
Synonyms  1-AGPAT4|LPAAT-delta|dJ473J16.2
Description  1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)
See related  HGNC:20885|Ensembl:ENSG00000026652|HPRD:12437|
Locus tag  RP3-473J16.2
Gene type  protein-coding
Map location  6q26
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:00038411-acylglycerol-3-phosphate O-acyltransferase activityNAS15367102 
GO:0016740transferase activityIEA-
GO:0008415acyltransferase activityIEA-
GO:0046027phospholipid:diacylglycerol acyltransferase activityEXP11487472 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008654phospholipid biosynthetic processNAS15367102 
GO:0008152metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolEXP11487472 
GO:0005575cellular_componentND-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29353359m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-377233239m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.