SZGR2

Summary ?

GeneID	56897
Symbol	WRNIP1
Synonyms	WHIP\|bA420G6.2
Description	Werner helicase interacting protein 1
Reference	MIM:608196\|HGNC:HGNC:20876\|Ensembl:ENSG00000124535\|HPRD:10494\|Vega:OTTHUMG00000014126
Gene type	protein-coding
Map location	6p25.2
Pascal p-value	0.372
Sherlock p-value	0.291
Fetal beta	-0.59
DMG	1 (# studies)
eGene	Meta
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GSMA_I	Genome scan meta-analysis	Psr: 0.0159

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg20466761	6	2766613	WRNIP1	1.08E-9	-0.015	1.22E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003677	DNA binding	IEA		-
GO:0005515	protein binding	IPI		15670210
GO:0005515	protein binding	ISS		-
GO:0005524	ATP binding	IC		15670210
GO:0016787	hydrolase activity	IEA		-
GO:0016887	ATPase activity	IMP		15670210
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000731	DNA synthesis during DNA repair	IDA		15670210
GO:0030174	regulation of DNA replication initiation	IDA		15670210
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	ISS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPAIR GENES	230	137	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPLICATION GENES	147	87	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-153	423	429	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-22	229	235	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-25/32/92/363/367	238	244	m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-320	231	237	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-448	422	429	1A,m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-543	250	256	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: WRNIP1