Gene Page: C5orf15

Summary
GeneID  56951
Symbol  C5orf15
Synonyms  HTGN29|KCT2
Description  chromosome 5 open reading frame 15
See related  HGNC:20656|Ensembl:ENSG00000113583|HPRD:12829|
Locus tag  -
Gene type  protein-coding
Map location  5q31.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-217126612721Ahsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-29120126m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-330123129m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-5436206261Ahsa-miR-543AAACAUUCGCGGUGCACUUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.