|
|
| GeneID |
56990
|
| Symbol |
CDC42SE2
|
| Synonyms |
FLJ21967|SPEC2
|
| Description |
CDC42 small effector 2 |
| See related |
HGNC:18547|Ensembl:ENSG00000158985|HPRD:16695| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
5q31.1 |
|
| |
|
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005515 | protein binding | IPI | | 10816584 |
| GO:0005198 | structural molecule activity | IDA | | 10816584 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0009966 | regulation of signal transduction | IDA | | 10816584 |
| GO:0008360 | regulation of cell shape | IEA | | - |
| GO:0006909 | phagocytosis | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005856 | cytoskeleton | IEA | | - |
| GO:0005737 | cytoplasm | IEA | | - |
| GO:0005886 | plasma membrane | IDA | | 10816584 |
| |
|
|
| |
|
| miR-218 | 381 | 388 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|