Gene Page: GOPC

Summary
GeneID  57120
Symbol  GOPC
Synonyms  CAL|FIG|GOPC1|PIST|dJ94G16.2
Description  golgi associated PDZ and coiled-coil motif containing
See related  HGNC:17643|MIM:606845|Ensembl:ENSG00000047932|HPRD:06024|
Locus tag  -
Gene type  protein-coding
Map location  6q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0042980cystic fibrosis transmembrane conductance regulator bindingIPI11707463 
GO:0050430syntaxin-6 bindingIPI11384996 |11707463 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0043004cytoplasmic sequestering of CFTR proteinNAS11707463 
GO:0006888ER to Golgi vesicle-mediated transportNAS11707463 
GO:0006893Golgi to plasma membrane transportNAS11707463 
GO:0015031protein transportIEA-
GO:0051260protein homooligomerizationIPI11707463 
GO:0045176apical protein localizationNAS11707463 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0042995cell projectionIEAaxon (GO term level: 4)-
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIDA11384996 
GO:0005624membrane fractionIDA11707463 
GO:0005737cytoplasmIDA11707463 
GO:0005886plasma membraneNAS11707463 
GO:0030140trans-Golgi network transport vesicleIDA11707463 
GO:0030140trans-Golgi network transport vesicleNAS11384996 
GO:0030054cell junctionIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACCN3ASIC3 | DRASIC | SLNAC1 | TNaC1amiloride-sensitive cation channel 3-HPRD,BioGRID15317815 
ASIC3 interacts with PIST.BIND15317815 
BECN1ATG6 | VPS30 | beclin1beclin 1, autophagy related-HPRD,BioGRID12372286 
CDC42CDC42Hs | G25Kcell division cycle 42 (GTP binding protein, 25kDa)Reconstituted ComplexBioGRID11162552 
CFTRABC35 | ABCC7 | CF | CFTR/MRP | MRP7 | TNR-CFTR | dJ760C5.1cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)-HPRD,BioGRID11707463 
CLCN3CLC3 | ClC-3chloride channel 3-HPRD,BioGRID12471024 
CSPG5MGC44034 | NGCchondroitin sulfate proteoglycan 5 (neuroglycan C)Affinity Capture-Western
Two-hybrid		BioGRID12885772 
FZD5C2orf31 | DKFZp434E2135 | HFZ5 | MGC129692frizzled homolog 5 (Drosophila)-HPRD11520064 
FZD8FZ-8 | hFZ8frizzled homolog 8 (Drosophila)-HPRD11520064 
GOPCCAL | FIG | GOPC1 | PIST | dJ94G16.2golgi associated PDZ and coiled-coil motif containing-HPRD,BioGRID11162552 
GRID2MGC117022 | MGC117023 | MGC117024glutamate receptor, ionotropic, delta 2Affinity Capture-Western
Two-hybrid		BioGRID12372286 
RHOQARHQ | RASL7A | TC10 | TC10Aras homolog gene family, member Q-HPRD,BioGRID11162552 
STX6-syntaxin 6FIG interacts with Syntaxin 6.BIND11384996 
-HPRD11384996 
VIMFLJ36605vimentinTwo-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/351125131m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-142-5p14041410m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-1866086141Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-231361421Ahsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-2926832689m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-369-3p286428711A,m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37428652871m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-493-5p159716031Ahsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-9236242m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.