Gene Page: PTGFR

Summary
GeneID  5737
Symbol  PTGFR
Synonyms  FP|MGC120498|MGC46203
Description  prostaglandin F receptor (FP)
See related  HGNC:9600|MIM:600563|Ensembl:ENSG00000122420|HPRD:08988|
Locus tag  RP5-944H6.1
Gene type  protein-coding
Map location  1p31.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.02692 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0004960thromboxane receptor activityIEA-
GO:0004958prostaglandin F receptor activityIEA-
GO:0004958prostaglandin F receptor activityTAS8300593 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007186G-protein coupled receptor protein signaling pathwayIEA-
GO:0007186G-protein coupled receptor protein signaling pathwayTAS8300593 
GO:0007165signal transductionIEA-
GO:0007567parturitionTAS9918852 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS8300593 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PTGDSLPGDS | PDS | PGD2 | PGDS | PGDS2prostaglandin D2 synthase 21kDa (brain)in vivoBioGRID8300593 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-14588951A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-23288228881Ahsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.