Gene Page: SERINC1

Summary
GeneID  57515
Symbol  SERINC1
Synonyms  KIAA1253|TDE1L|TDE2|TMS-2
Description  serine incorporator 1
See related  HGNC:13464|Ensembl:ENSG00000111897|HPRD:15480|
Locus tag  -
Gene type  protein-coding
Map location  6q22.31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingISS-
GO:0015194L-serine transmembrane transporter activityISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008654phospholipid biosynthetic processIEA-
GO:0015825L-serine transportISS-
GO:0006665sphingolipid metabolic processISS-
GO:0006658phosphatidylserine metabolic processISS-
GO:0006629lipid metabolic processIEA-
GO:0051347positive regulation of transferase activityISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneISS-
GO:0005783endoplasmic reticulumIEA-
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneISS-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-200bc/4295157m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.