Gene Page: CGN

Summary
GeneID  57530
Symbol  CGN
Synonyms  DKFZp779N1112|FLJ39281|KIAA1319
Description  cingulin
See related  HGNC:17429|MIM:609473|Ensembl:ENSG00000143375|HPRD:10827|
Locus tag  -
Gene type  protein-coding
Map location  1q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003779actin bindingISS-
GO:0003774motor activityIEA-
GO:0005515protein bindingIPI11042084 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionNASBrain (GO term level: 10)12529927 
GO:0016459myosin complexIEA-
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGEF2DKFZp547L106 | DKFZp547P1516 | GEF | GEF-H1 | GEFH1 | KIAA0651 | LFP40 | P40rho/rac guanine nucleotide exchange factor (GEF) 2ARHGEF2 (GEF-H1) interacts with CGN (Cingulin). This interaction was modeled on a demonstrated interaction between canine GEF-H1 and canine and human Cingulin.BIND15866167 
SFNYWHASstratifinAffinity Capture-MSBioGRID15778465 
TJP1DKFZp686M05161 | MGC133289 | ZO-1tight junction protein 1 (zona occludens 1)-HPRD,BioGRID10613913 |12023291|11042084 
-HPRD11042084 
Cingulin interacts with ZO-1.BIND10613913 
TJP2MGC26306 | X104 | ZO-2 | ZO2tight junction protein 2 (zona occludens 2)-HPRD,BioGRID11042084 
-HPRD10613913 |12023291|11042084 
YWHABGW128 | HS1 | KCIP-1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptideAffinity Capture-MSBioGRID17353931 
YWHAG14-3-3GAMMAtyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1601607m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5066006071A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-125/3513663731A,m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-1856646701Ahsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-1863423491A,m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-1883093161A,m8hsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
miR-194904971A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-3203363421Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-409-3p6546601Ahsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.