Summary ?
GeneID57596
SymbolBEGAIN
Synonyms-
Descriptionbrain enriched guanylate kinase associated
ReferenceHGNC:HGNC:24163|Ensembl:ENSG00000183092|HPRD:06459|Vega:OTTHUMG00000171589
Gene typeprotein-coding
Map location14q32.2
Pascal p-value0.041
Sherlock p-value0.287
SupportINTRACELLULAR SIGNAL TRANSDUCTION

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0119 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI16189514 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIDA18029348 
GO:0005634nucleusIDA18029348 
GO:0005737cytoplasmIEA-
GO:0016020membraneIEA-

Section IV. Protein-protein interaction annotation

InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABLIM1ABLIM | DKFZp781D0148 | FLJ14564 | KIAA0059 | LIMAB1 | LIMATIN | MGC1224actin binding LIM protein 1Two-hybridBioGRID16189514 
BAHD1KIAA0945bromo adjacent homology domain containing 1Two-hybridBioGRID16189514 
BEGAINKIAA1446brain-enriched guanylate kinase-associated homolog (rat)-HPRD,BioGRID12097487 
C16orf48DAKV6410 | DKFZp434A1319chromosome 16 open reading frame 48Two-hybridBioGRID16189514 
C17orf28DMC1 | FLJ43526chromosome 17 open reading frame 28Two-hybridBioGRID16189514 
CATSPER1CATSPER | MGC33335 | MGC33368cation channel, sperm associated 1Two-hybridBioGRID16189514 
DEF6IBP | SLATdifferentially expressed in FDCP 6 homolog (mouse)Two-hybridBioGRID16189514 
DLG1DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlgdiscs, large homolog 1 (Drosophila)-HPRD9756850 
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)-HPRD9756850 
DTNBMGC17163 | MGC57126dystrobrevin, betaTwo-hybridBioGRID16189514 
FAM107ADRR1 | FLJ30158 | FLJ45473 | TU3Afamily with sequence similarity 107, member ATwo-hybridBioGRID16189514 
HGSHRS | ZFYVE8hepatocyte growth factor-regulated tyrosine kinase substrateTwo-hybridBioGRID16189514 
KIAA0408FLJ43995 | RP3-403A15.2KIAA0408Two-hybridBioGRID16189514 
RBL1CP107 | MGC40006 | PRB1 | p107retinoblastoma-like 1 (p107)Affinity Capture-Western
Two-hybrid
BioGRID16189514 
RIBC2C22orf11RIB43A domain with coiled-coils 2Two-hybridBioGRID16189514 
TRIM27RFP | RNF76tripartite motif-containing 27Two-hybridBioGRID16189514 
USP2UBP41 | USP9ubiquitin specific peptidase 2Two-hybridBioGRID16189514 
ZFP64MGC940 | ZNF338zinc finger protein 64 homolog (mouse)Two-hybridBioGRID16189514 
ZNF250FLJ57354 | MGC111123 | MGC9718 | ZFP647 | ZNF647zinc finger protein 250Two-hybridBioGRID16189514 
ZNF417MGC34079zinc finger protein 417Two-hybridBioGRID16189514 


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
MULLIGHAN MLL SIGNATURE 1 UP 380236All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418263All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL DN 11879All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL DN 186107All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390236All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP 281183All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/986957021A,m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU