Gene Page: SH3RF1
Summary ?
| GeneID | 57630 |
| Symbol | SH3RF1 |
| Synonyms | POSH|RNF142|SH3MD2 |
| Description | SH3 domain containing ring finger 1 |
| Reference | HGNC:HGNC:17650|Ensembl:ENSG00000154447|HPRD:15335|Vega:OTTHUMG00000161010 |
| Gene type | protein-coding |
| Map location | 4q32.3 |
| Pascal p-value | 2E-5 |
| Fetal beta | -0.928 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 17535800 | |
| GO:0016874 | ligase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0042995 | cell projection | IEA | axon (GO term level: 4) | - |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| LIU PROSTATE CANCER UP | 96 | 57 | All SZGR 2.0 genes in this pathway |
| JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
| WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP | 137 | 84 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL FGF3 | 8 | 7 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| HANSON HRAS SIGNALING VIA NFKB | 22 | 14 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| STEARMAN LUNG CANCER EARLY VS LATE DN | 61 | 39 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
| BREDEMEYER RAG SIGNALING NOT VIA ATM UP | 62 | 29 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2 | 86 | 50 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 215 | 221 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-128 | 997 | 1004 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-18 | 1385 | 1391 | 1A | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
| hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
| miR-186 | 1897 | 1904 | 1A,m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-218 | 47 | 53 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-26 | 327 | 333 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-27 | 998 | 1005 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-30-5p | 290 | 297 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-320 | 1857 | 1863 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
| miR-342 | 942 | 948 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
| miR-505 | 1764 | 1771 | 1A,m8 | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.