Gene Page: EP400

Summary
GeneID  57634
Symbol  EP400
Synonyms  CAGH32|DKFZP434I225|FLJ42018|FLJ45115|P400|TNRC12
Description  E1A binding protein p400
See related  HGNC:11958|MIM:606265|Ensembl:ENSG00000183495|HPRD:09378|
Locus tag  -
Gene type  protein-coding
Map location  12q24.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003677DNA bindingIEA-
GO:0005524ATP bindingIEA-
GO:0004386helicase activityIEA-
GO:0016787hydrolase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016568chromatin modificationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTL6AACTL6 | Arp4 | BAF53A | INO80K | MGC5382actin-like 6AAffinity Capture-MSBioGRID11509179 
KAT5ESA1 | HTATIP | HTATIP1 | PLIP | TIP | TIP60 | cPLA2K(lysine) acetyltransferase 5Affinity Capture-WesternBioGRID11509179 
MAXMGC10775 | MGC11225 | MGC18164 | MGC34679 | MGC36767 | bHLHd4 | orf1MYC associated factor XAffinity Capture-WesternBioGRID11509179 
MYCbHLHe39 | c-Mycv-myc myelocytomatosis viral oncogene homolog (avian)Affinity Capture-Western
Reconstituted Complex
BioGRID11509179 
RUVBL1ECP54 | INO80H | NMP238 | PONTIN | Pontin52 | RVB1 | TIH1 | TIP49 | TIP49ARuvB-like 1 (E. coli)Affinity Capture-MS
Affinity Capture-Western
Reconstituted Complex
BioGRID11509179 
RUVBL2CGI-46 | ECP51 | INO80J | REPTIN | RVB2 | TIH2 | TIP48 | TIP49BRuvB-like 2 (E. coli)Affinity Capture-MSBioGRID11509179 
TBC1D4AS160 | DKFZp779C0666TBC1 domain family, member 4-HPRD12421765 
TRRAPFLJ10671 | PAF350/400 | PAF400 | STAF40 | TR-AP | Tra1transformation/transcription domain-associated protein-HPRD,BioGRID11509179 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-26271227191A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.