Gene Page: EPB41L5

Summary
GeneID  57669
Symbol  EPB41L5
Synonyms  BE37|FLJ12957|KIAA1548
Description  erythrocyte membrane protein band 4.1 like 5
See related  HGNC:19819|MIM:611730|Ensembl:ENSG00000115109|HPRD:13273|
Locus tag  -
Gene type  protein-coding
Map location  2q14.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.023 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00755 
ExpressionExpressionP value: 1.363 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0008092cytoskeletal protein bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIEA-
GO:0030054cell junctionIEA-
GO:0019898extrinsic to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1451621691A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-1841551621A,m8hsa-miR-184UGGACGGAGAACUGAUAAGGGU
miR-320125112571Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.