Gene Page: CHD8
Summary ?
| GeneID | 57680 |
| Symbol | CHD8 |
| Synonyms | AUTS18|HELSNF1 |
| Description | chromodomain helicase DNA binding protein 8 |
| Reference | MIM:610528|HGNC:HGNC:20153|Ensembl:ENSG00000100888|HPRD:16712|Vega:OTTHUMG00000170759 |
| Gene type | protein-coding |
| Map location | 14q11.2 |
| Pascal p-value | 0.047 |
| Sherlock p-value | 0.018 |
| TADA p-value | 0.006 |
| Fetal beta | 0.248 |
| Support | CompositeSet Darnell FMRP targets Ascano FMRP targets Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:McCarthy_2014 | Whole Exome Sequencing analysis | Whole exome sequencing of 57 trios with sporadic or familial schizophrenia. | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.047 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CHD8 | chr14 | 21860919 | C | A | NM_001170629 | p.S2173X | nonsense SNV | Schizophrenia | DNM:McCarthy_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003677 | DNA binding | IEA | - | |
| GO:0003682 | chromatin binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 16949368 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004386 | helicase activity | IEA | - | |
| GO:0016787 | hydrolase activity | IEA | - | |
| GO:0030528 | transcription regulator activity | NAS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006333 | chromatin assembly or disassembly | IEA | - | |
| GO:0006355 | regulation of transcription, DNA-dependent | NAS | - | |
| GO:0006350 | transcription | IEA | - | |
| GO:0016568 | chromatin modification | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000785 | chromatin | IEA | - | |
| GO:0005634 | nucleus | NAS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
| PID BETA CATENIN NUC PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS | 185 | 114 | All SZGR 2.0 genes in this pathway |
| SHIPP DLBCL CURED VS FATAL UP | 39 | 22 | All SZGR 2.0 genes in this pathway |
| MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
| STEARMAN LUNG CANCER EARLY VS LATE UP | 125 | 89 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1 | 68 | 50 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
| YUAN ZNF143 PARTNERS | 22 | 15 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-140 | 284 | 290 | 1A | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
| miR-155 | 389 | 395 | 1A | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-221/222 | 295 | 301 | m8 | hsa-miR-221brain | AGCUACAUUGUCUGCUGGGUUUC |
| hsa-miR-222brain | AGCUACAUCUGGCUACUGGGUCUC | ||||
| miR-365 | 388 | 394 | 1A | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| miR-376c | 293 | 299 | 1A | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
| miR-504 | 357 | 363 | 1A | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.