Gene Page: CPNE5

Summary
GeneID  57699
Symbol  CPNE5
Synonyms  COPN5|CPN5|DKFZp666C234|KIAA1599
Description  copine V
See related  HGNC:2318|MIM:604209|Ensembl:ENSG00000124772|HPRD:05018|
Locus tag  -
Gene type  protein-coding
Map location  6p21.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.033 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1145714641A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/506145714631Ahsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.