SZGR2

Summary ?

GeneID	57724
Symbol	EPG5
Synonyms	HEEW1\|KIAA1632\|VICIS
Description	ectopic P-granules autophagy protein 5 homolog (C. elegans)
Reference	MIM:615068\|HGNC:HGNC:29331\|Ensembl:ENSG00000152223\|HPRD:11157\|Vega:OTTHUMG00000132626
Gene type	protein-coding
Map location	18q12.3
Pascal p-value	0.893
Fetal beta	0.525
DMG	1 (# studies)
eGene	Caudate basal ganglia Cerebellum Cortex

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg26311295	18	43547356	EPG5	4.04E-9	-0.008	2.49E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TEX10	0.92	0.91
KARS	0.92	0.92
POLR1E	0.92	0.90
ZNF195	0.92	0.91
UIMC1	0.91	0.86
ZNF227	0.91	0.90
ZCCHC7	0.91	0.89
EFTUD1	0.91	0.91
NOL11	0.91	0.91
DDX5	0.91	0.91

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HLA-F	-0.71	-0.80
MT-CO2	-0.70	-0.82
AF347015.27	-0.70	-0.82
TINAGL1	-0.70	-0.80
AF347015.33	-0.70	-0.83
AF347015.31	-0.70	-0.82
IFI27	-0.69	-0.86
AF347015.8	-0.68	-0.82
AIFM3	-0.68	-0.78
MT-CYB	-0.67	-0.80

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP	292	168	All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE UP	109	68	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-148/152	4577	4583	1A	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-23	1707	1713	1A	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1707	1713	1A	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-25/32/92/363/367	4716	4723	1A,m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-30-5p	38	45	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EPG5