Gene Page: KIAA1967

Summary
GeneID  57805
Symbol  KIAA1967
Synonyms  DBC-1|DBC1
Description  KIAA1967
See related  HGNC:23360|MIM:607359|Ensembl:ENSG00000158941|HPRD:09159|
Locus tag  -
Gene type  protein-coding
Map location  8p22
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.03086 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.00057 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003674molecular_functionND-
GO:0005515protein bindingIPI17314511 |17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006915apoptosisIDA15824730 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA15824730 
GO:0005737cytoplasmIDA15824730 
GO:0005759mitochondrial matrixIDA15824730 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTR3BARP11 | ARP3BETA | DKFZp686O24114ARP3 actin-related protein 3 homolog B (yeast)Affinity Capture-MSBioGRID17353931 
CCNA1-cyclin A1Affinity Capture-MSBioGRID17353931 
CIAO1CIA1 | WDR39cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
GSTK1GST13glutathione S-transferase kappa 1Affinity Capture-MSBioGRID17353931 
MAGEA6MAGE-3b | MAGE3B | MAGE6 | MGC52297melanoma antigen family A, 6Affinity Capture-MSBioGRID17353931 
MAGED1DLXIN-1 | NRAGEmelanoma antigen family D, 1Affinity Capture-MSBioGRID17353931 
MAP3K7IP2FLJ21885 | KIAA0733 | TAB2mitogen-activated protein kinase kinase kinase 7 interacting protein 2-HPRD14743216 
MYCbHLHe39 | c-Mycv-myc myelocytomatosis viral oncogene homolog (avian)Affinity Capture-MSBioGRID17353931 
NEK6SID6-1512NIMA (never in mitosis gene a)-related kinase 6Affinity Capture-MSBioGRID17353931 
TH1LHSPC130 | NELF-C | NELF-D | TH1TH1-like (Drosophila)Affinity Capture-MSBioGRID17353931 
TRADDHs.89862 | MGC11078TNFRSF1A-associated via death domain-HPRD14743216 
WDR8FLJ20430 | MGC99569WD repeat domain 8Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1385996051Ahsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-299-5p7697751Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-315855921A,m8hsa-miR-31AGGCAAGAUGCUGGCAUAGCUG
miR-3817187241Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-485-5p129135m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
miR-539268274m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-9772778m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.