Gene Page: PXN

Summary
GeneID  5829
Symbol  PXN
Synonyms  FLJ16691
Description  paxillin
See related  HGNC:9718|MIM:602505|Ensembl:ENSG00000089159|
Locus tag  hCG_1778014
Gene type  protein-coding
Map location  12q24.31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0679 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
RAB11A0.910.91
FBXO30.910.89
KIFAP30.910.91
CUL20.910.89
MED40.900.90
YWHAZ0.900.89
RAB2A0.900.88
PNMA10.900.89
DYNC1LI10.900.89
GLOD40.900.89
Top 10 negatively co-expressed genes
MT-CO2-0.78-0.76
FXYD1-0.78-0.77
AF347015.33-0.77-0.74
AF347015.31-0.75-0.75
MT-CYB-0.75-0.74
AF347015.8-0.74-0.73
AF347015.2-0.73-0.74
AF347015.21-0.72-0.70
HIGD1B-0.72-0.72
AF347015.27-0.72-0.72
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI14688263 
GO:0008270zinc ion bindingIEA-
GO:0017166vinculin bindingIPI9054445 
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007172signal complex assemblyTAS9054445 
GO:0007160cell-matrix adhesionIEA-
GO:0007155cell adhesionNAS10840040 
GO:0007165signal transductionTAS7534286 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIEA-
GO:0005875microtubule associated complexTAS10840040 
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneEXP15574420 
GO:0030054cell junctionIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABL1ABL | JTK7 | bcr/abl | c-ABL | p150 | v-ablc-abl oncogene 1, receptor tyrosine kinase-HPRD9603926 
ARHGAP5GFI2 | RhoGAP5 | p190-BRho GTPase activating protein 5Affinity Capture-WesternBioGRID10092539 
ASAP1AMAP1 | CENTB4 | DDEF1 | KIAA1249 | PAG2 | PAP | ZG14PArfGAP with SH3 domain, ankyrin repeat and PH domain 1in vitroBioGRID12149250 
ASAP2AMAP2 | CENTB3 | DDEF2 | FLJ42910 | KIAA0400 | PAG3 | PAP | Pap-alpha | SHAG1ArfGAP with SH3 domain, ankyrin repeat and PH domain 2in vitro
Reconstituted Complex
BioGRID10749932 |12149250 
-HPRD10749932|12149250 
BCAR1CAS | CAS1 | CASS1 | CRKAS | P130Casbreast cancer anti-estrogen resistance 1Affinity Capture-WesternBioGRID8810278 |11577104 
BCRALL | BCR-ABL1 | BCR1 | CML | D22S11 | D22S662 | FLJ16453 | PHLbreakpoint cluster regionAffinity Capture-Western
Co-purification
BioGRID7534286 |8641358 
CBLC-CBL | CBL2 | RNF55Cas-Br-M (murine) ecotropic retroviral transforming sequenceCo-purificationBioGRID8641358 
CEACAM1BGP | BGP1 | BGPIcarcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)-HPRD,BioGRID11035932 
CRKCRKIIv-crk sarcoma virus CT10 oncogene homolog (avian)-HPRD,BioGRID12198159 
CRKL-v-crk sarcoma virus CT10 oncogene homolog (avian)-like-HPRD,BioGRID7493940 
CSKMGC117393c-src tyrosine kinase-HPRD,BioGRID7529872 
CTTNEMS1 | FLJ34459cortactinPXN (Paxillin) interacts with an unspecified isoform of CTTN (cortactin).BIND15719014 
FYNMGC45350 | SLK | SYNFYN oncogene related to SRC, FGR, YES-HPRD,BioGRID10804218 
GIT1-G protein-coupled receptor kinase interacting ArfGAP 1GIT1 interacts with Paxillin (PXN).BIND15793570 
Affinity Capture-WesternBioGRID12629171 
-HPRD10896954 |12153727 
|14523024 
GIT2CAT-2 | DKFZp686G01261 | KIAA0148 | MGC760G protein-coupled receptor kinase interacting ArfGAP 2-HPRD,BioGRID11251077 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2Reconstituted ComplexBioGRID10085298 
GSNDKFZp313L0718gelsolin (amyloidosis, Finnish type)-HPRD,BioGRID11577104 
IGF1RCD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216insulin-like growth factor 1 receptorAffinity Capture-WesternBioGRID10082579 
ILKDKFZp686F1765 | P59integrin-linked kinase-HPRD,BioGRID11304546 |11694518 
ITGA4CD49D | IA4 | MGC90518integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)-HPRD,BioGRID11533025 |11919182 
Paxillin (PXN) interacts with integrin alpha-4 (ITGA4).BIND10604475 
ITGA6CD49f | DKFZp686J01244 | FLJ18737 | ITGA6B | VLA-6integrin, alpha 6-HPRD,BioGRID12033289 
ITGA9ALPHA-RLC | ITGA4L | RLCintegrin, alpha 9-HPRD,BioGRID11598204 
ITGB1CD29 | FNRB | GPIIA | MDF2 | MSK12 | VLA-BETA | VLABintegrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)-HPRD,BioGRID7657702|10804218 
ITGB3CD61 | GP3A | GPIIIaintegrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)Reconstituted ComplexBioGRID11683411 
LCKYT16 | p56lck | pp58lcklymphocyte-specific protein tyrosine kinase-HPRD,BioGRID9488700 
LIMK1LIMKLIM domain kinase 1-HPRD15023529 
MATKCHK | CTK | DKFZp434N1212 | HHYLTK | HYL | HYLTK | Lsk | MGC1708 | MGC2101megakaryocyte-associated tyrosine kinase-HPRD,BioGRID10080957 
NCK1MGC12668 | NCK | NCKalphaNCK adaptor protein 1-HPRD,BioGRID10330411 
NEDD9CAS-L | CAS2 | CASL | CASS2 | HEF1 | dJ49G10.2 | dJ761I2.1neural precursor cell expressed, developmentally down-regulated 9-HPRD,BioGRID10455189 
NF2ACN | BANF | SCHneurofibromin 2 (merlin)-HPRD,BioGRID12118253 
PABPC1PAB1 | PABP | PABP1 | PABPC2 | PABPL1poly(A) binding protein, cytoplasmic 1-HPRD,BioGRID11704675 
PAK1MGC130000 | MGC130001 | PAKalphap21 protein (Cdc42/Rac)-activated kinase 1-HPRD10330411 
PAK3CDKN1A | MRX30 | MRX47 | OPHN3 | PAK3beta | bPAK | hPAK3p21 protein (Cdc42/Rac)-activated kinase 3-HPRD11096073 
PARVAFLJ10793 | FLJ12254 | MXRA2parvin, alpha-HPRD11134073 
PIK3R1GRB1 | p85 | p85-ALPHAphosphoinositide-3-kinase, regulatory subunit 1 (alpha)Co-purificationBioGRID8641358 
PKD1PBPpolycystic kidney disease 1 (autosomal dominant)-HPRD11113628 
PKLRPK1 | PKL | PKR | PKRL | RPKpyruvate kinase, liver and RBCAffinity Capture-WesternBioGRID12006652 
PPP2CAPP2Ac | PP2CA | RP-Cprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoformAffinity Capture-WesternBioGRID10675325 
PTEN10q23del | BZS | MGC11227 | MHAM | MMAC1 | PTEN1 | TEP1phosphatase and tensin homolog-HPRD,BioGRID11857088 
PTK2FADK | FAK | FAK1 | pp125FAKPTK2 protein tyrosine kinase 2FAK interacts with paxillin.BIND11113628 
-HPRD,BioGRID8922390 
PTK2BCADTK | CAKB | FADK2 | FAK2 | FRNK | PKB | PTK | PYK2 | RAFTKPTK2B protein tyrosine kinase 2 beta-HPRD,BioGRID9099734 
PTPN11BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2protein tyrosine phosphatase, non-receptor type 11-HPRD8986614 |10082579 
|10655584 
PTPN12PTP-PEST | PTPG1protein tyrosine phosphatase, non-receptor type 12-HPRD10085298 |10400685 
|10625692 |11950600 
Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID9497381 |10400685 
|10625692 
PTPRHFLJ39938 | MGC133058 | MGC133059 | SAP-1protein tyrosine phosphatase, receptor type, H-HPRD,BioGRID11278335 
RAB8BFLJ38125RAB8B, member RAS oncogene familyAffinity Capture-WesternBioGRID12639940 
RASA1CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAPRAS p21 protein activator (GTPase activating protein) 1-HPRD,BioGRID10092539 
REPS2POB1RALBP1 associated Eps domain containing 2-HPRD,BioGRID12149250 
SELECD62E | ELAM | ELAM1 | ESEL | LECAM2selectin E-HPRD,BioGRID8609175 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)Reconstituted ComplexBioGRID10085298 
-HPRD7534286 
SYKDKFZp313N1010 | FLJ25043 | FLJ37489spleen tyrosine kinase-HPRD,BioGRID9590268 
TGFB1I1ARA55 | HIC-5 | HIC5 | TSC-5transforming growth factor beta 1 induced transcript 1Affinity Capture-WesternBioGRID11463817 
TLN1ILWEQ | KIAA1027 | TLNtalin 1-HPRD,BioGRID7534286 
TRIP6MGC10556 | MGC10558 | MGC29959 | MGC3837 | MGC4423 | OIP1 | ZRP-1thyroid hormone receptor interactor 6-HPRD,BioGRID14688263 
TUBA1BK-ALPHA-1tubulin, alpha 1b-HPRD10840040 
TUBA3CTUBA2 | bA408E5.3tubulin, alpha 3c-HPRD10840040 
TUBG1TUBG | TUBGCP1tubulin, gamma 1-HPRD,BioGRID10840040 |11950600 
TUBG2MGC131994tubulin, gamma 2-HPRD10840040 
VCLCMD1W | MVCLvinculin-HPRD,BioGRID9054445 
-HPRD7525621 |7534286|9054445 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-132/212984990m8hsa-miR-212SZUAACAGUCUCCAGUCACGGCC
hsa-miR-132brainUAACAGUCUACAGCCAUGGUCG
miR-1376396451Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-1451021091A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-1993143211A,m8hsa-miR-199aCCCAGUGUUCAGACUACCUGUUC
hsa-miR-199bCCCAGUGUUUAGACUAUCUGUUC
miR-2189209261Ahsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-32614541460m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.