Gene Page: SNX6

Summary
GeneID  58533
Symbol  SNX6
Synonyms  MGC3157|MSTP010|TFAF2
Description  sorting nexin 6
See related  HGNC:14970|MIM:606098|Ensembl:ENSG00000129515|HPRD:12086|
Locus tag  -
Gene type  protein-coding
Map location  14q13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.2955 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI11279102 
GO:0042803protein homodimerization activityIPI11279102 
GO:0035091phosphoinositide bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007175negative regulation of epidermal growth factor receptor activityNAS11279102 
GO:0007154cell communicationIEA-
GO:0006886intracellular protein transportNAS11279102 
GO:0016481negative regulation of transcriptionIDA11279102 
GO:0030512negative regulation of transforming growth factor beta receptor signaling pathwayIDA11279102 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularNAS11279102 
GO:0005737cytoplasmIDA11279102 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACVR2BACTRIIB | ActR-IIB | MGC116908activin A receptor, type IIB-HPRD,BioGRID11279102 
ACVRL1ACVRLK1 | ALK-1 | ALK1 | HHT | HHT2 | ORW2 | SKR3 | TSR-Iactivin A receptor type II-like 1-HPRD,BioGRID11279102 
BMPR1BALK-6 | ALK6 | CDw293bone morphogenetic protein receptor, type IB-HPRD,BioGRID11279102 
EGFRERBB | ERBB1 | HER1 | PIG61 | mENAepidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)-HPRD,BioGRID11279102 
INSRCD220 | HHF5insulin receptor-HPRD,BioGRID11279102 
LEPRCD295 | OBRleptin receptor-HPRD,BioGRID11279102 
PDGFRACD140A | MGC74795 | PDGFR2 | Rhe-PDGFRAplatelet-derived growth factor receptor, alpha polypeptide-HPRD,BioGRID11279102 
PIM1PIMpim-1 oncogene-HPRD11591366 
-HPRD,BioGRID11279102 
SMAD1BSP1 | JV4-1 | JV41 | MADH1 | MADR1SMAD family member 1-HPRD11279102 
SNX1HsT17379 | MGC8664 | SNX1A | Vps5sorting nexin 1Affinity Capture-Western
in vitro
in vivo
BioGRID11279102 
SNX2MGC5204 | TRG-9sorting nexin 2-HPRD,BioGRID11279102 
SNX4-sorting nexin 4-HPRD,BioGRID11279102 
TGFBR1AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1transforming growth factor, beta receptor 1-HPRD,BioGRID11279102 
TGFBR2AAT3 | FAA3 | LDS1B | LDS2B | MFS2 | RIIC | TAAD2 | TGFR-2 | TGFbeta-RIItransforming growth factor, beta receptor II (70/80kDa)-HPRD,BioGRID11279102 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.15835901A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5065835891Ahsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-142-5p5375431Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-299-5p6016071Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-30-5p128812951A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.