Gene Page: ENPP5
Summary ?
| GeneID | 59084 |
| Symbol | ENPP5 |
| Synonyms | NPP-5 |
| Description | ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) |
| Reference | HGNC:HGNC:13717|Ensembl:ENSG00000112796|HPRD:13272|Vega:OTTHUMG00000014781 |
| Gene type | protein-coding |
| Map location | 6p21.1-p11.2 |
| Pascal p-value | 0.009 |
| Sherlock p-value | 0.285 |
| eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Frontal Cortex BA9 Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs9472701 | chr6 | 46116448 | ENPP5 | 59084 | 0.12 | cis | ||
| rs2223776 | chr6 | 46145460 | ENPP5 | 59084 | 0.17 | cis | ||
| rs7153322 | chr14 | 55584613 | ENPP5 | 59084 | 0.2 | trans | ||
| rs17128262 | chr14 | 55619767 | ENPP5 | 59084 | 0.2 | trans | ||
| rs10144869 | chr14 | 55726091 | ENPP5 | 59084 | 0.04 | trans | ||
| rs10135891 | chr14 | 55862955 | ENPP5 | 59084 | 0.2 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NUMBL | 0.93 | 0.94 |
| FAM160A2 | 0.89 | 0.90 |
| MCOLN1 | 0.88 | 0.88 |
| SLC45A1 | 0.87 | 0.88 |
| SEMA4F | 0.87 | 0.89 |
| SH2D3C | 0.86 | 0.90 |
| RTN4RL1 | 0.86 | 0.91 |
| LRFN3 | 0.86 | 0.88 |
| AGPAT1 | 0.86 | 0.88 |
| CADM3 | 0.86 | 0.89 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AP002478.3 | -0.64 | -0.69 |
| AL139819.3 | -0.64 | -0.68 |
| AF347015.21 | -0.63 | -0.67 |
| MT-CO2 | -0.62 | -0.63 |
| AF347015.31 | -0.62 | -0.61 |
| NOSTRIN | -0.61 | -0.65 |
| AF347015.33 | -0.61 | -0.59 |
| AF347015.8 | -0.61 | -0.62 |
| GNG11 | -0.60 | -0.68 |
| MT-CYB | -0.60 | -0.60 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016787 | hydrolase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008152 | metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| LIU SOX4 TARGETS UP | 137 | 94 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
| FURUKAWA DUSP6 TARGETS PCI35 UP | 74 | 32 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| LEE AGING MUSCLE UP | 45 | 33 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
| KONDO PROSTATE CANCER WITH H3K27ME3 | 196 | 93 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER SURVIVAL UP | 185 | 112 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
| IVANOVSKA MIR106B TARGETS | 90 | 56 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| KOHOUTEK CCNT1 TARGETS | 50 | 26 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 SIGNALING VIA NFIC 10HR UP | 54 | 38 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-130/301 | 295 | 302 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
| hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
| hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
| miR-17-5p/20/93.mr/106/519.d | 365 | 372 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-19 | 294 | 300 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.