Gene Page: ACE2

Summary
GeneID  59272
Symbol  ACE2
Synonyms  ACEH|DKFZp434A014
Description  angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
See related  HGNC:13557|MIM:300335|Ensembl:ENSG00000130234|HPRD:02274|
Locus tag  -
Gene type  protein-coding
Map location  Xp22
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0001618viral receptor activityIDA18343844 
GO:0001948glycoprotein bindingIPI18343844 
GO:0004180carboxypeptidase activityIDA10969042 
GO:0008270zinc ion bindingIEA-
GO:0008241peptidyl-dipeptidase activityIDA10924499 
GO:0008237metallopeptidase activityIDA10924499 
GO:0008233peptidase activityIEA-
GO:0031404chloride ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0032800receptor biosynthetic processIMPNeurotransmitter (GO term level: 5)18258853 
GO:0003051angiotensin-mediated drinking behaviorIMPBrain (GO term level: 13)18258853 
GO:0003081regulation of systemic arterial blood pressure by renin-angiotensinIC10924499 
GO:0003081regulation of systemic arterial blood pressure by renin-angiotensinIMP18258853 
GO:0002005angiotensin catabolic process in bloodIC10924499 
GO:0001817regulation of cytokine productionIC15380922 
GO:0006508proteolysisIEA-
GO:0006800oxygen and reactive oxygen species metabolic processIC15380922 
GO:0042312regulation of vasodilationIC15380922 
GO:0042127regulation of cell proliferationTAS17703127 
GO:0019229regulation of vasoconstrictionIC15380922 
GO:0050727regulation of inflammatory responseIC15380922 
GO:0044419interspecies interaction between organismsIEA-
GO:0046718entry of virus into host cellTAS15165741 
GO:0046813virion attachment, binding of host cell surface receptorIDA18343844 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIDA10969042 
GO:0005615extracellular spaceIDA18258853 
GO:0005634nucleusIDA18029348 
GO:0016021integral to membraneIEA-
GO:0009986cell surfaceIDA18343844 
GO:0005886plasma membraneIEA-
GO:0045121membrane raftTAS18279660 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-200bc/429179185m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.