Gene Page: TRMT11

Summary
GeneID  60487
Symbol  TRMT11
Synonyms  C6orf75|MDS024|TRM11|dJ187J11|dJ187J11.2
Description  tRNA methyltransferase 11 homolog (S. cerevisiae)
See related  HGNC:21080|Ensembl:ENSG00000066651|HPRD:12898|
Locus tag  RP1-187J11.2
Gene type  protein-coding
Map location  6q11.1-q22.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003676nucleic acid bindingIEA-
GO:0003677DNA bindingIEA-
GO:0016740transferase activityIEA-
GO:0008170N-methyltransferase activityIEA-
GO:0008168methyltransferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006306DNA methylationIEA-
GO:0008033tRNA processingIEA-
GO:0032259methylationIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4101081141Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.