Gene Page: ACSM3
Summary ?
| GeneID | 6296 |
| Symbol | ACSM3 |
| Synonyms | SA|SAH |
| Description | acyl-CoA synthetase medium-chain family member 3 |
| Reference | MIM:145505|HGNC:HGNC:10522|Ensembl:ENSG00000005187|HPRD:07033|Vega:OTTHUMG00000131552 |
| Gene type | protein-coding |
| Map location | 16p13.11 |
| Pascal p-value | 0.046 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TRERF1 | 0.68 | 0.76 |
| HS6ST2 | 0.68 | 0.74 |
| FOXRED2 | 0.64 | 0.75 |
| NRXN3 | 0.64 | 0.74 |
| ABAT | 0.64 | 0.71 |
| MAGI1 | 0.64 | 0.74 |
| TSHZ1 | 0.63 | 0.70 |
| SH3RF1 | 0.63 | 0.74 |
| AJAP1 | 0.62 | 0.67 |
| PCDH1 | 0.61 | 0.68 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C1orf54 | -0.39 | -0.49 |
| MT-CO2 | -0.39 | -0.44 |
| AF347015.21 | -0.38 | -0.45 |
| AL139819.3 | -0.37 | -0.45 |
| AF347015.31 | -0.36 | -0.41 |
| NOSTRIN | -0.36 | -0.40 |
| FXYD1 | -0.36 | -0.38 |
| S100A13 | -0.36 | -0.38 |
| HIGD1B | -0.36 | -0.39 |
| CLEC2B | -0.35 | -0.44 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0000287 | magnesium ion binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0016874 | ligase activity | IEA | - | |
| GO:0015645 | fatty-acid ligase activity | IEA | - | |
| GO:0047760 | butyrate-CoA ligase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008217 | regulation of blood pressure | NAS | 7907320 | |
| GO:0008152 | metabolic process | IEA | - | |
| GO:0006633 | fatty acid biosynthetic process | IEA | - | |
| GO:0006629 | lipid metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005575 | cellular_component | ND | - | |
| GO:0005739 | mitochondrion | IEA | - | |
| GO:0005759 | mitochondrial matrix | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG BUTANOATE METABOLISM | 34 | 20 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN | 175 | 82 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| DOANE RESPONSE TO ANDROGEN UP | 184 | 125 | All SZGR 2.0 genes in this pathway |
| BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
| OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP | 182 | 110 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 6 7WK DN | 79 | 54 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
| LIANG HEMATOPOIESIS STEM CELL NUMBER SMALL VS HUGE DN | 33 | 22 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER DENA DN | 74 | 45 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| ROSS AML WITH AML1 ETO FUSION | 76 | 55 | All SZGR 2.0 genes in this pathway |
| HSIAO LIVER SPECIFIC GENES | 244 | 154 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
| BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SURVIVAL DN | 113 | 76 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
| ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN | 116 | 74 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-140 | 58 | 65 | 1A,m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.