Gene Page: PERP

Summary
GeneID  64065
Symbol  PERP
Synonyms  KCP1|KRTCAP1|PIGPC1|RP3-496H19.1|THW|dJ496H19.1
Description  PERP, TP53 apoptosis effector
See related  HGNC:17637|MIM:609301|Ensembl:ENSG00000112378|HPRD:17836|
Locus tag  -
Gene type  protein-coding
Map location  6q24
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0005198structural molecule activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007155cell adhesionIEA-
GO:0006917induction of apoptosisIEA-
GO:0006915apoptosisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIEA-
GO:0005739mitochondrionIEA-
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneIEA-
GO:0030054cell junctionIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-299-5p123912451Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.