Gene Page: AZI2

Summary
GeneID  64343
Symbol  AZI2
Synonyms  AZ2|NAP1|TILP
Description  5-azacytidine induced 2
See related  HGNC:24002|MIM:609916|Ensembl:ENSG00000163512|HPRD:10577|
Locus tag  -
Gene type  protein-coding
Map location  3p24.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007249I-kappaB kinase/NF-kappaB cascadeIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ODC1ODCornithine decarboxylase 1Reconstituted ComplexBioGRID12359729 
TBK1FLJ11330 | NAK | T2KTANK-binding kinase 1-HPRD14743216 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-266076131Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-44814131419m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.