Gene Page: HIF3A

Summary
GeneID  64344
Symbol  HIF3A
Synonyms  HIF-3A|HIF-3A2|HIF-3A4|IPAS|MOP7|PASD7|bHLHe17
Description  hypoxia inducible factor 3, alpha subunit
See related  HGNC:15825|MIM:609976|Ensembl:ENSG00000124440|HPRD:17104|
Locus tag  -
Gene type  protein-coding
Map location  19q13.32
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.688 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004871signal transducer activityIEA-
GO:0003700transcription factor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001666response to hypoxiaIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006366transcription from RNA polymerase II promoterIEA-
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
HIF1AHIF-1alpha | HIF1 | HIF1-ALPHA | MOP1 | PASD8hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)-HPRD11734856 
VHLHRCA1 | RCA1 | VHL1von Hippel-Lindau tumor suppressor-HPRD12538644 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29352635331A,m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.