Gene Page: IKZF4
Summary ?
GeneID | 64375 |
Symbol | IKZF4 |
Synonyms | EOS|ZNFN1A4 |
Description | IKAROS family zinc finger 4 |
Reference | MIM:606239|HGNC:HGNC:13179|Ensembl:ENSG00000123411|HPRD:05874|Vega:OTTHUMG00000170132 |
Gene type | protein-coding |
Map location | 12q13 |
Pascal p-value | 0.288 |
Fetal beta | 1.077 |
DMG | 2 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 3 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0576 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg20359445 | 12 | 56415591 | IKZF4 | 9.06E-6 | -0.006 | 0.042 | DMG:Montano_2016 |
cg20054248 | 12 | 56414508 | IKZF4 | 2.89E-4 | -0.004 | 0.177 | DMG:Montano_2016 |
cg20359445 | 12 | 56415591 | IKZF4 | 4.197E-4 | 0.245 | 0.045 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 10978333 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0016564 | transcription repressor activity | TAS | 10978333 | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | TAS | 10978333 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CHD4 | DKFZp686E06161 | Mi-2b | Mi2-BETA | chromodomain helicase DNA binding protein 4 | - | HPRD,BioGRID | 12015313 |
CTBP1 | BARS | MGC104684 | C-terminal binding protein 1 | - | HPRD,BioGRID | 12444977 |
HDAC2 | RPD3 | YAF1 | histone deacetylase 2 | - | HPRD,BioGRID | 12015313 |
HDAC4 | HA6116 | HD4 | HDAC-A | HDACA | KIAA0288 | histone deacetylase 4 | Affinity Capture-Western | BioGRID | 12015313 |
HDAC5 | FLJ90614 | HD5 | NY-CO-9 | histone deacetylase 5 | Affinity Capture-Western | BioGRID | 12015313 |
HDAC7 | DKFZp586J0917 | FLJ99588 | HD7A | HDAC7A | histone deacetylase 7 | Affinity Capture-Western | BioGRID | 12015313 |
IKZF1 | Hs.54452 | IK1 | IKAROS | LYF1 | PRO0758 | ZNFN1A1 | hIk-1 | IKAROS family zinc finger 1 (Ikaros) | - | HPRD,BioGRID | 10218586 |10978333 |
IKZF2 | HELIOS | MGC34330 | ZNF1A2 | ZNFN1A2 | IKAROS family zinc finger 2 (Helios) | - | HPRD | 10978333 |
IKZF3 | AIO | AIOLOS | ZNFN1A3 | IKAROS family zinc finger 3 (Aiolos) | - | HPRD,BioGRID | 10978333 |
IKZF4 | EOS | KIAA1782 | ZNFN1A4 | IKAROS family zinc finger 4 (Eos) | - | HPRD,BioGRID | 10218586 |10978333 |
IKZF5 | DKFZp781B0249 | FLJ22973 | PEGASUS | ZNFN1A5 | IKAROS family zinc finger 5 (Pegasus) | - | HPRD,BioGRID | 10978333 |
NRG1 | ARIA | GGF | GGF2 | HGL | HRG | HRG1 | HRGA | NDF | SMDF | neuregulin 1 | Nrg-1 interacts with Eos. This interaction was modeled on a demonstrated interaction between Nrg-1 from an unspecified species and Eos from an unspecified species. | BIND | 15494726 |
SIN3A | DKFZp434K2235 | FLJ90319 | KIAA0700 | SIN3 homolog A, transcription regulator (yeast) | Affinity Capture-Western | BioGRID | 12015313 |
SIN3B | KIAA0700 | SIN3 homolog B, transcription regulator (yeast) | Affinity Capture-Western | BioGRID | 12015313 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
BROWN MYELOID CELL DEVELOPMENT DN | 129 | 86 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P7 | 90 | 52 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS UP | 221 | 120 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE | 151 | 86 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 3053 | 3060 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
hsa-miR-101 | UACAGUACUGUGAUAACUGAAG | ||||
miR-125/351 | 871 | 877 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-128 | 660 | 666 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-130/301 | 585 | 592 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-137 | 1962 | 1968 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-144 | 3040 | 3046 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG | ||||
miR-17-5p/20/93.mr/106/519.d | 2406 | 2413 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-185 | 2388 | 2395 | 1A,m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
hsa-miR-185brain | UGGAGAGAAAGGCAGUUC | ||||
hsa-miR-185brain | UGGAGAGAAAGGCAGUUC | ||||
miR-216 | 1540 | 1546 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
miR-22 | 579 | 585 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-25/32/92/363/367 | 2802 | 2809 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-28 | 396 | 402 | m8 | hsa-miR-28brain | AAGGAGCUCACAGUCUAUUGAG |
miR-29 | 2356 | 2362 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-365 | 512 | 518 | 1A | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
miR-381 | 2991 | 2997 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-504 | 2416 | 2422 | m8 | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
miR-539 | 2943 | 2949 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
miR-9 | 1550 | 1556 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.