SZGR2

Summary ?

GeneID	64375
Symbol	IKZF4
Synonyms	EOS\|ZNFN1A4
Description	IKAROS family zinc finger 4
Reference	MIM:606239\|HGNC:HGNC:13179\|Ensembl:ENSG00000123411\|HPRD:05874\|Vega:OTTHUMG00000170132
Gene type	protein-coding
Map location	12q13
Pascal p-value	0.288
Fetal beta	1.077
DMG	2 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Montano_2016	Genome-wide DNA methylation analysis	This dataset includes 172 replicated associations between CpGs with schizophrenia.	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0576

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg20359445	12	56415591	IKZF4	9.06E-6	-0.006	0.042	DMG:Montano_2016
cg20054248	12	56414508	IKZF4	2.89E-4	-0.004	0.177	DMG:Montano_2016
cg20359445	12	56415591	IKZF4	4.197E-4	0.245	0.045	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	TAS		10978333
GO:0008270	zinc ion binding	IEA		-
GO:0016564	transcription repressor activity	TAS		10978333
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	TAS		10978333

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CHD4	DKFZp686E06161 \| Mi-2b \| Mi2-BETA	chromodomain helicase DNA binding protein 4	-	HPRD,BioGRID	12015313
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	-	HPRD,BioGRID	12444977
HDAC2	RPD3 \| YAF1	histone deacetylase 2	-	HPRD,BioGRID	12015313
HDAC4	HA6116 \| HD4 \| HDAC-A \| HDACA \| KIAA0288	histone deacetylase 4	Affinity Capture-Western	BioGRID	12015313
HDAC5	FLJ90614 \| HD5 \| NY-CO-9	histone deacetylase 5	Affinity Capture-Western	BioGRID	12015313
HDAC7	DKFZp586J0917 \| FLJ99588 \| HD7A \| HDAC7A	histone deacetylase 7	Affinity Capture-Western	BioGRID	12015313
IKZF1	Hs.54452 \| IK1 \| IKAROS \| LYF1 \| PRO0758 \| ZNFN1A1 \| hIk-1	IKAROS family zinc finger 1 (Ikaros)	-	HPRD,BioGRID	10218586 \|10978333
IKZF2	HELIOS \| MGC34330 \| ZNF1A2 \| ZNFN1A2	IKAROS family zinc finger 2 (Helios)	-	HPRD	10978333
IKZF3	AIO \| AIOLOS \| ZNFN1A3	IKAROS family zinc finger 3 (Aiolos)	-	HPRD,BioGRID	10978333
IKZF4	EOS \| KIAA1782 \| ZNFN1A4	IKAROS family zinc finger 4 (Eos)	-	HPRD,BioGRID	10218586 \|10978333
IKZF5	DKFZp781B0249 \| FLJ22973 \| PEGASUS \| ZNFN1A5	IKAROS family zinc finger 5 (Pegasus)	-	HPRD,BioGRID	10978333
NRG1	ARIA \| GGF \| GGF2 \| HGL \| HRG \| HRG1 \| HRGA \| NDF \| SMDF	neuregulin 1	Nrg-1 interacts with Eos. This interaction was modeled on a demonstrated interaction between Nrg-1 from an unspecified species and Eos from an unspecified species.	BIND	15494726
SIN3A	DKFZp434K2235 \| FLJ90319 \| KIAA0700	SIN3 homolog A, transcription regulator (yeast)	Affinity Capture-Western	BioGRID	12015313
SIN3B	KIAA0700	SIN3 homolog B, transcription regulator (yeast)	Affinity Capture-Western	BioGRID	12015313

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
BROWN MYELOID CELL DEVELOPMENT DN	129	86	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P7	90	52	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS UP	221	120	All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1	467	251	All SZGR 2.0 genes in this pathway
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE	151	86	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	3053	3060	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-101	3053	3060	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-125/351	871	877	m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	871	877	m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-128	660	666	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	660	666	m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-130/301	585	592	1A,m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-137	1962	1968	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-144	3040	3046	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-144	3040	3046	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-17-5p/20/93.mr/106/519.d	2406	2413	1A,m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-185	2388	2395	1A,m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
				hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
				hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-216	1540	1546	m8	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-22	579	585	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-25/32/92/363/367	2802	2809	1A,m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-28	396	402	m8	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-29	2356	2362	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-365	512	518	1A	hsa-miR-365	UAAUGCCCCUAAAAAUCCUUAU
miR-381	2991	2997	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-504	2416	2422	m8	hsa-miR-504	AGACCCUGGUCUGCACUCUAU
miR-539	2943	2949	1A	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-9	1550	1556	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: IKZF4