Gene Page: IKZF5

Summary
GeneID  64376
Symbol  IKZF5
Synonyms  DKFZp781B0249|FLJ22973|PEGASUS|ZNFN1A5
Description  IKAROS family zinc finger 5 (Pegasus)
See related  HGNC:14283|MIM:606238|Ensembl:ENSG00000095574|HPRD:05873|
Locus tag  -
Gene type  protein-coding
Map location  10q26
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.03487 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CCDC85BDIPAcoiled-coil domain containing 85BTwo-hybridBioGRID16189514 
IKZF1Hs.54452 | IK1 | IKAROS | LYF1 | PRO0758 | ZNFN1A1 | hIk-1IKAROS family zinc finger 1 (Ikaros)Reconstituted Complex
Two-hybrid
BioGRID10978333 
IKZF2HELIOS | MGC34330 | ZNF1A2 | ZNFN1A2IKAROS family zinc finger 2 (Helios)-HPRD10978333 
IKZF3AIO | AIOLOS | ZNFN1A3IKAROS family zinc finger 3 (Aiolos)-HPRD,BioGRID10978333 
IKZF4EOS | KIAA1782 | ZNFN1A4IKAROS family zinc finger 4 (Eos)-HPRD,BioGRID10978333 
IKZF5DKFZp781B0249 | FLJ22973 | PEGASUS | ZNFN1A5IKAROS family zinc finger 5 (Pegasus)-HPRD,BioGRID10978333 
LDOC1BCUR1 | Mar7 | Mart7leucine zipper, down-regulated in cancer 1Two-hybridBioGRID16189514 
PUM2FLJ36528 | KIAA0235 | MGC138251 | MGC138253 | PUMH2 | PUML2pumilio homolog 2 (Drosophila)PUM2 interacts with NRE. This interaction was modeled on a demonstrated interaction between human PUM2 and fly NRE.BIND12511597 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a424430m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-1833723781Ahsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-98248311A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.