Gene Page: MICAL1

Summary
GeneID  64780
Symbol  MICAL1
Synonyms  DKFZp434B1517|FLJ11937|FLJ21739|MICAL|MICAL-1|NICAL
Description  microtubule associated monoxygenase, calponin and LIM domain containing 1
See related  HGNC:20619|MIM:607129|Ensembl:ENSG00000135596|HPRD:06183|
Locus tag  RP5-919F19.1
Gene type  protein-coding
Map location  6q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI11827972 
GO:0005515protein bindingISS-
GO:0004497monooxygenase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0017124SH3 domain bindingIPI11827972 
GO:0017124SH3 domain bindingISS-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007010cytoskeleton organizationNAS11827972 
GO:0007165signal transductionNAS11827972 
GO:0006725cellular aromatic compound metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIEA-
GO:0005882intermediate filamentNAS11827972 
GO:0005737cytoplasmIDA11827972 
GO:0005737cytoplasmISS-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABL1ABL | JTK7 | bcr/abl | c-ABL | p150 | v-ablc-abl oncogene 1, receptor tyrosine kinaseReconstituted ComplexBioGRID11827972 
CRKCRKIIv-crk sarcoma virus CT10 oncogene homolog (avian)Reconstituted ComplexBioGRID11827972 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2Reconstituted ComplexBioGRID11827972 
NEDD9CAS-L | CAS2 | CASL | CASS2 | HEF1 | dJ49G10.2 | dJ761I2.1neural precursor cell expressed, developmentally down-regulated 9-HPRD,BioGRID11827972 
PTK2FADK | FAK | FAK1 | pp125FAKPTK2 protein tyrosine kinase 2-HPRD10808124 
RAB1ADKFZp564B163 | RAB1 | YPT1RAB1A, member RAS oncogene familyReconstituted Complex
Two-hybrid		BioGRID12788069 
RAB1B-RAB1B, member RAS oncogene familyMICAL1 interacts with RAB1B.BIND15796781 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)Reconstituted ComplexBioGRID11827972 
VIMFLJ36605vimentin-HPRD,BioGRID11827972 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-5p1001071A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.