|
|
| GeneID |
64901
|
| Symbol |
RANBP17
|
| Synonyms |
FLJ32916
|
| Description |
RAN binding protein 17 |
| See related |
HGNC:14428|MIM:606141|Ensembl:ENSG00000204764|HPRD:05847| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
5q34 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_IIA | genome scan meta-analysis (All samples) | Psr: 0.0276 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005488 | binding | IEA | | - |
| GO:0005525 | GTP binding | NAS | | 11024021 |
| GO:0008565 | protein transporter activity | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0000059 | protein import into nucleus, docking | IEA | | - |
| GO:0051028 | mRNA transport | IEA | | - |
| GO:0065002 | intracellular protein transmembrane transport | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005634 | nucleus | IEA | | - |
| GO:0005643 | nuclear pore | NAS | | 11024021 |
| GO:0005737 | cytoplasm | IEA | | - |
| |
|
| miR-151 | 639 | 646 | 1A,m8 | hsa-miR-151brain | ACUAGACUGAAGCUCCUUGAGG | | miR-361 | 555 | 562 | 1A,m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC | | miR-9 | 288 | 295 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
