Gene Page: MRPL9

Summary
GeneID  65005
Symbol  MRPL9
Synonyms  L9mt
Description  mitochondrial ribosomal protein L9
See related  HGNC:14277|MIM:611824|Ensembl:ENSG00000143436|HPRD:14774|
Locus tag  RP11-98D18.5
Gene type  protein-coding
Map location  1q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003735structural constituent of ribosomeNAS11543634 
GO:0045182translation regulator activityNAS11543634 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006412translationNAS11543634 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005840ribosomeIEA-
GO:0005622intracellularIEA-
GO:0005739mitochondrionIEA-
GO:0005761mitochondrial ribosomeNAS11543634 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-212282351A,m8hsa-miR-21brainUAGCUUAUCAGACUGAUGUUGA
hsa-miR-590GAGCUUAUUCAUAAAAGUGCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.