Gene Page: SMARCB1

Summary
GeneID  6598
Symbol  SMARCB1
Synonyms  BAF47|INI1|RDT|SNF5|SNF5L1|Sfh1p|Snr1|hSNFS
Description  SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
See related  HGNC:11103|MIM:601607|Ensembl:ENSG00000099956|HPRD:03364|
Locus tag  -
Gene type  protein-coding
Map location  22q11.23|22q11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0143 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
ALDOA0.890.91
BSCL20.890.91
C17orf790.890.91
SNX170.890.90
BCAP310.880.90
SNURF0.880.89
FKBP80.880.91
STUB10.870.90
ABHD120.870.91
ATP6V1E10.860.87
Top 10 negatively co-expressed genes
EIF5B-0.56-0.62
AC005921.3-0.51-0.70
THOC2-0.48-0.45
AC010300.1-0.46-0.45
RBMX2-0.46-0.51
CCAR1-0.46-0.40
UPF3B-0.45-0.45
ZNF326-0.45-0.43
SFRS18-0.44-0.58
UPF3A-0.44-0.47
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15985610 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001835blastocyst hatchingIEA-
GO:0006357regulation of transcription from RNA polymerase II promoterTAS7801128 
GO:0006350transcriptionIEA-
GO:0006338chromatin remodelingIEA-
GO:0008285negative regulation of cell proliferationIEA-
GO:0030154cell differentiationIEA-
GO:0015074DNA integrationTAS7801128 
GO:0045090retroviral genome replicationIDA14963118 
GO:0045786negative regulation of cell cycleIEA-
GO:0044419interspecies interaction between organismsIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000228nuclear chromosomeIEA-
GO:0001741XY bodyIEA-
GO:0005634nucleusIDA11430827 
GO:0005654nucleoplasmTAS7801128 
GO:0016514SWI/SNF complexIDA8895581 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTL6AACTL6 | Arp4 | BAF53A | INO80K | MGC5382actin-like 6ACo-purificationBioGRID8895581 
ARID1AB120 | BAF250 | BAF250a | BM029 | C1orf4 | P270 | SMARCF1AT rich interactive domain 1A (SWI-like)Affinity Capture-MS
Co-purification		BioGRID8895581 |11734557 
ARID1B6A3-5 | BAF250b | BRIGHT | DAN15 | ELD/OSA1 | KIAA1235 | p250RAT rich interactive domain 1B (SWI1-like)Affinity Capture-MSBioGRID11734557 
BAZ1BWBSCR10 | WBSCR9 | WSTFbromodomain adjacent to zinc finger domain, 1B-HPRD,BioGRID12837248 
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onsetCo-purificationBioGRID10943845 
CCNE1CCNEcyclin E1Affinity Capture-WesternBioGRID9891079 
CDK8K35 | MGC126074 | MGC126075cyclin-dependent kinase 8Affinity Capture-Western
Co-fractionation		BioGRID9710619 
CEBPBC/EBP-beta | CRP2 | IL6DBP | LAP | MGC32080 | NF-IL6 | TCF5CCAAT/enhancer binding protein (C/EBP), beta-HPRD10619021 
CREBBPCBP | KAT3A | RSTSCREB binding proteinAffinity Capture-Western
Co-fractionation		BioGRID9710619 
GATA1ERYF1 | GF-1 | GF1 | NFE1GATA binding protein 1 (globin transcription factor 1)Reconstituted ComplexBioGRID11018012 
HDAC1DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1histone deacetylase 1Co-purificationBioGRID11238380 
HDAC2RPD3 | YAF1histone deacetylase 2Co-purificationBioGRID11238380 
HSF1HSTF1heat shock transcription factor 1Co-fractionationBioGRID11486022 
ING1p24ING1c | p33 | p33ING1 | p33ING1b | p47 | p47ING1ainhibitor of growth family, member 1Affinity Capture-MSBioGRID11784859 
KAT2BCAF | P | P/CAF | PCAFK(lysine) acetyltransferase 2BAffinity Capture-WesternBioGRID9710619 
KLF1EKLFKruppel-like factor 1 (erythroid)Reconstituted ComplexBioGRID11018012 
MED21SRB7 | SURB7mediator complex subunit 21Affinity Capture-WesternBioGRID9710619 
MLLALL-1 | CXXC7 | FLJ11783 | HRX | HTRX1 | KMT2A | MLL/GAS7 | MLL1A | TET1-MLL | TRX1myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)Affinity Capture-WesternBioGRID10490642 
MLLT10AF10 | DKFZp686E10210 | MGC75086myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10Affinity Capture-WesternBioGRID11756182 
MYCbHLHe39 | c-Mycv-myc myelocytomatosis viral oncogene homolog (avian)-HPRD,BioGRID10319872 
NCOR1KIAA1047 | MGC104216 | N-CoR | TRAC1 | hCIT529I10 | hN-CoRnuclear receptor co-repressor 1Co-purificationBioGRID11013263 
NR3C1GCCR | GCR | GR | GRLnuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)-HPRD10688647 
POLR2AMGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1polymerase (RNA) II (DNA directed) polypeptide A, 220kDa-HPRD,BioGRID9710619 
PPP1CAMGC15877 | MGC1674 | PP-1A | PPP1Aprotein phosphatase 1, catalytic subunit, alpha isoformAffinity Capture-Western
Phenotypic Enhancement
Reconstituted Complex		BioGRID12016208 
PPP1CBMGC3672 | PP-1B | PPP1CDprotein phosphatase 1, catalytic subunit, beta isoformAffinity Capture-Western
Phenotypic Enhancement
Reconstituted Complex		BioGRID12016208 
PPP1CCPPP1Gprotein phosphatase 1, catalytic subunit, gamma isoformAffinity Capture-Western
Phenotypic Enhancement
Reconstituted Complex		BioGRID12016208 
PPP1R15AGADD34protein phosphatase 1, regulatory (inhibitor) subunit 15AAffinity Capture-Western
Reconstituted Complex		BioGRID10490642 |12016208 
RANARA24 | Gsp1 | TC4RAN, member RAS oncogene familyReconstituted ComplexBioGRID11782423 
RB1OSRC | RB | p105-Rb | pRb | pp110retinoblastoma 1-HPRD11085541 
RBBP4NURF55 | RBAP48retinoblastoma binding protein 4Co-purificationBioGRID11238380 
RELBI-REL | IRELv-rel reticuloendotheliosis viral oncogene homolog BAffinity Capture-MSBioGRID14743216 
SIN3ADKFZp434K2235 | FLJ90319 | KIAA0700SIN3 homolog A, transcription regulator (yeast)Co-purificationBioGRID11238380 
SMARCA2BAF190 | BRM | FLJ36757 | MGC74511 | SNF2 | SNF2L2 | SNF2LA | SWI2 | Sth1p | hBRM | hSNF2aSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2Co-purificationBioGRID8895581 |11238380 
SMARCA4BAF190 | BRG1 | FLJ39786 | SNF2 | SNF2-BETA | SNF2L4 | SNF2LB | SWI2 | hSNF2bSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4-HPRD,BioGRID8895581 
SMARCB1BAF47 | INI1 | RDT | SNF5 | SNF5L1 | Sfh1p | Snr1 | hSNFSSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1Co-purificationBioGRID10943845 
SMARCC1BAF155 | CRACC1 | Rsc8 | SRG3 | SWI3SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1Co-purificationBioGRID8895581 |11238380 
SMARCC2BAF170 | CRACC2 | Rsc8SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2Co-purificationBioGRID8895581 
SMARCE1BAF57SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1Affinity Capture-Western
Co-purification		BioGRID8895581 |9845365 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)-HPRD12145209 
SS18MGC116875 | SSXT | SYT | SYT-SSX1 | SYT-SSX2synovial sarcoma translocation, chromosome 18Affinity Capture-MS
Affinity Capture-Western		BioGRID11734557 
TACC2AZU-1 | ECTACCtransforming, acidic coiled-coil containing protein 2-HPRD,BioGRID12620397 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD,BioGRID11950834 
UBQLN4A1U | C1orf6 | CIP75 | UBINubiquilin 4Two-hybridBioGRID16169070 
XPO1CRM1 | DKFZp686B1823exportin 1 (CRM1 homolog, yeast)-HPRD,BioGRID11782423 
YEATS44930573H17Rik | B230215M10Rik | GAS41 | NUBI-1 | YAF9YEATS domain containing 4-HPRD,BioGRID11756182 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2061581651A,m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-3812632691Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.