Gene Page: SPARC

Summary
GeneID  6678
Symbol  SPARC
Synonyms  ON
Description  secreted protein, acidic, cysteine-rich (osteonectin)
See related  HGNC:11219|MIM:182120|Ensembl:ENSG00000113140|HPRD:01631|
Locus tag  -
Gene type  protein-coding
Map location  5q31.3-q32
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00459 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01718 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005507copper ion bindingIEA-
GO:0005509calcium ion bindingTAS7034958 
GO:0005518collagen bindingTAS7034958 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001503ossificationTAS7034958 
GO:0007169transmembrane receptor protein tyrosine kinase signaling pathwayNAS15609325 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionEXP1737102 
GO:0005576extracellular regionNAS14718574 
GO:0005604basement membraneIEA-
GO:0031093platelet alpha granule lumenEXP1737102 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
COL13A1COLXIIIA1 | FLJ42485collagen, type XIII, alpha 1-HPRD,BioGRID11956183 
COL1A1OI4collagen, type I, alpha 1-HPRD7034958 
Reconstituted ComplexBioGRID2745554 
COL1A2OI4collagen, type I, alpha 2-HPRD7034958 
COL2A1ANFH | AOM | COL11A3 | MGC131516 | SEDCcollagen, type II, alpha 1-HPRD2745554 
COL3A1EDS4A | FLJ34534collagen, type III, alpha 1Reconstituted ComplexBioGRID2745554 
COL5A1-collagen, type V, alpha 1Reconstituted ComplexBioGRID2745554 
HSPG2PLC | PRCAN | SJA | SJS | SJS1heparan sulfate proteoglycan 2-HPRD2745554 
PDGFBFLJ12858 | PDGF2 | SIS | SSV | c-sisplatelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)Reconstituted ComplexBioGRID1311092 
PLATDKFZp686I03148 | T-PA | TPAplasminogen activator, tissue-HPRD2745554 
PLGDKFZp779M0222plasminogen-HPRD,BioGRID2745554 |7982919 
SDC2HSPG | HSPG1 | SYND2syndecan 2-HPRD2745554 
SPARCONsecreted protein, acidic, cysteine-rich (osteonectin)-HPRD9233787 
TGFB1CED | DPD1 | TGFB | TGFbetatransforming growth factor, beta 1-HPRD15034927 
TGM2G-ALPHA-h | GNAH | TG2 | TGCtransglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)-HPRD7730416 
THBS1THBS | TSP | TSP1thrombospondin 1-HPRD2745554 |3402455 
VEGFAMGC70609 | VEGF | VEGF-A | VPFvascular endothelial growth factor A-HPRD,BioGRID9792673 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.1103310391Ahsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-291041101Ahsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-339130113071Ahsa-miR-339UCCCUGUCCUCCAGGAGCUCA
miR-433-3p103710431Ahsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
miR-452124112481A,m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.