|
|
| GeneID |
6862
|
| Symbol |
T
|
| Synonyms |
MGC104817|TFT
|
| Description |
T, brachyury homolog (mouse) |
| See related |
HGNC:11515|MIM:601397|Ensembl:ENSG00000164458|HPRD:03236| |
| Locus tag |
RP11-459F1.1 |
| Gene type |
protein-coding |
| Map location |
6q27 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia] | Click to show detail |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| RBM34 | 0.91 | 0.90 | | |
| SARNP | 0.91 | 0.88 | | |
| ARL3 | 0.91 | 0.89 | | |
| TMSB10 | 0.89 | 0.88 | | |
| TPRKB | 0.89 | 0.86 | | |
| LSM3 | 0.89 | 0.89 | | |
| PSMA2 | 0.88 | 0.85 | | |
| AC008073.1 | 0.88 | 0.87 | | |
| CWC15 | 0.88 | 0.88 | | |
| EIF3M | 0.87 | 0.86 | | |
Top 10 negatively co-expressed genes | | SLC6A12 | -0.62 | -0.74 | | |
| HLA-F | -0.61 | -0.70 | | |
| TINAGL1 | -0.60 | -0.73 | | |
| ATP10A | -0.60 | -0.71 | | |
| APOL3 | -0.60 | -0.72 | | |
| GPER | -0.59 | -0.69 | | |
| ZBTB7B | -0.59 | -0.72 | | |
| HLA-E | -0.58 | -0.70 | | |
| PRELP | -0.57 | -0.67 | | |
| EPAS1 | -0.57 | -0.70 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0003700 | transcription factor activity | IEA | | - |
| GO:0003700 | transcription factor activity | NAS | | 8963900 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0001756 | somitogenesis | IEA | | - |
| GO:0001570 | vasculogenesis | IEA | | - |
| GO:0001843 | neural tube closure | IEA | | - |
| GO:0001839 | neural plate morphogenesis | IEA | | - |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | | - |
| GO:0007165 | signal transduction | NAS | | 8963900 |
| GO:0008284 | positive regulation of cell proliferation | IEA | | - |
| GO:0009653 | anatomical structure morphogenesis | IEA | | - |
| GO:0008595 | determination of anterior/posterior axis, embryo | TAS | | 8963900 |
| GO:0007498 | mesoderm development | TAS | | 8963900 |
| GO:0007275 | multicellular organismal development | IEA | | - |
| GO:0030903 | notochord development | IEA | | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005634 | nucleus | IEA | | - |
| GO:0005737 | cytoplasm | IEA | | - |
| |
|
| miR-219 | 612 | 619 | 1A,m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU | | miR-9 | 607 | 613 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|