Gene Page: TEAD3
Summary ?
GeneID | 7005 |
Symbol | TEAD3 |
Synonyms | DTEF-1|ETFR-1|TEAD-3|TEAD5|TEF-5|TEF5 |
Description | TEA domain transcription factor 3 |
Reference | MIM:603170|HGNC:HGNC:11716|Ensembl:ENSG00000007866|HPRD:04411|Vega:OTTHUMG00000014571 |
Gene type | protein-coding |
Map location | 6p21.2 |
Pascal p-value | 0.529 |
Fetal beta | -0.154 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003702 | RNA polymerase II transcription factor activity | TAS | 9148898 | |
GO:0016563 | transcription activator activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 9148898 | |
GO:0006350 | transcription | IEA | - | |
GO:0007565 | female pregnancy | TAS | 9148898 | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005667 | transcription factor complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME PPARA ACTIVATES GENE EXPRESSION | 104 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME YAP1 AND WWTR1 TAZ STIMULATED GENE EXPRESSION | 24 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME GENERIC TRANSCRIPTION PATHWAY | 352 | 181 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION MUSCLE DN | 51 | 28 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 657 | 663 | m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-101 | 1177 | 1183 | m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-369-3p | 1289 | 1295 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 1289 | 1295 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.