Gene Page: UBE2E1

Summary
GeneID  7324
Symbol  UBE2E1
Synonyms  UBCH6
Description  ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)
See related  HGNC:12477|MIM:602916|Ensembl:ENSG00000170142|HPRD:04225|
Locus tag  -
Gene type  protein-coding
Map location  3p24.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.006 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI14667819 
GO:0004842ubiquitin-protein ligase activityTAS8576257 
GO:0016874ligase activityIEA-
GO:0042296ISG15 ligase activityIDA16428300 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006511ubiquitin-dependent protein catabolic processTAS8576257 
GO:0031145anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic processEXP11285280 
GO:0051246regulation of protein metabolic processIEA-
GO:0032020ISG15-protein conjugationIDA16428300 
GO:0051436negative regulation of ubiquitin-protein ligase activity during mitotic cell cycleEXP14593737 |15029244 
GO:0051437positive regulation of ubiquitin-protein ligase activity during mitotic cell cycleEXP10793135 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolEXP10793135 |11285280 |11535616 
|11742988 |12070128 
GO:0005654nucleoplasmEXP10548110 |11340163 |15029244 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CBWD5DC36 | FLJ34856 | FLJ40320 | FLJ77192 | MGC167043 | MGC44166COBW domain containing 5Two-hybridBioGRID16169070 
NEDD4KIAA0093 | MGC176705 | NEDD4-1 | RPF1neural precursor cell expressed, developmentally down-regulated 4-HPRD,BioGRID9990509 
NEDD4LFLJ33870 | KIAA0439 | NEDD4-2 | RSP5 | hNedd4-2neural precursor cell expressed, developmentally down-regulated 4-like-HPRD8576257 
PAEPGD | GdA | GdF | GdS | MGC138509 | MGC142288 | PAEG | PEP | PP14progestagen-associated endometrial proteinTwo-hybridBioGRID16169070 
RNF14ARA54 | FLJ26004 | HFB30 | HRIHFB2038 | TRIAD2ring finger protein 14-HPRD,BioGRID11322894 
RNF8FLJ12013 | KIAA0646ring finger protein 8-HPRD,BioGRID11322894 
UBE2G1E217K | UBC7 | UBE2Gubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast)-HPRD,BioGRID8393731 
UBE3AANCR | AS | E6-AP | EPVE6AP | FLJ26981 | HPVE6Aubiquitin protein ligase E3A-HPRD8576257 
UBOX5KIAA0860 | RNF37 | UBCE7IP5 | UIP5U-box domain containing 5-HPRD11274149 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4963373431Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-499124130m8hsa-miR-499UUAAGACUUGCAGUGAUGUUUAA
miR-542-3p32391A,m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.