Gene Page: UBP1
Summary ?
GeneID | 7342 |
Symbol | UBP1 |
Synonyms | LBP-1B|LBP-1a|LBP1A|LBP1B |
Description | upstream binding protein 1 (LBP-1a) |
Reference | MIM:609784|HGNC:HGNC:12507|Ensembl:ENSG00000153560|HPRD:10291|Vega:OTTHUMG00000130749 |
Gene type | protein-coding |
Map location | 3p22.3 |
Pascal p-value | 0.002 |
Sherlock p-value | 0.395 |
eGene | Cerebellar Hemisphere Cerebellum Frontal Cortex BA9 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ATP5A1 | 0.94 | 0.93 |
COPS3 | 0.92 | 0.88 |
DRG1 | 0.91 | 0.86 |
PMPCB | 0.91 | 0.87 |
CIAPIN1 | 0.91 | 0.88 |
PSMA1 | 0.91 | 0.87 |
FH | 0.90 | 0.90 |
C1QBP | 0.90 | 0.86 |
RAN | 0.90 | 0.91 |
HSPA8 | 0.90 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.2 | -0.72 | -0.67 |
AF347015.8 | -0.71 | -0.66 |
MT-CO2 | -0.71 | -0.64 |
AF347015.26 | -0.70 | -0.67 |
MT-CYB | -0.70 | -0.65 |
AF347015.33 | -0.68 | -0.65 |
AF347015.15 | -0.68 | -0.64 |
AF347015.31 | -0.68 | -0.63 |
AF347015.18 | -0.67 | -0.70 |
AF347015.21 | -0.67 | -0.63 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 8114710 | |
GO:0003714 | transcription corepressor activity | TAS | 8114710 | |
GO:0016566 | specific transcriptional repressor activity | TAS | 8114710 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 8114710 | |
GO:0016481 | negative regulation of transcription | TAS | 8114710 | |
GO:0019079 | viral genome replication | TAS | 8114710 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | TAS | 8114710 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES CD4 DN | 116 | 71 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
MORI PRE BI LYMPHOCYTE DN | 77 | 49 | All SZGR 2.0 genes in this pathway |
KAUFFMANN DNA REPLICATION GENES | 147 | 87 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
LEE METASTASIS AND ALTERNATIVE SPLICING DN | 45 | 31 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
SUZUKI CTCFL TARGETS UP | 12 | 5 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-138 | 1912 | 1919 | 1A,m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-181 | 340 | 347 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-219 | 1082 | 1088 | 1A | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-34/449 | 171 | 178 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-365 | 360 | 366 | m8 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
miR-377 | 52 | 59 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-494 | 103 | 110 | 1A,m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.