Gene Page: VASP
Summary ?
| GeneID | 7408 |
| Symbol | VASP |
| Synonyms | - |
| Description | vasodilator-stimulated phosphoprotein |
| Reference | MIM:601703|HGNC:HGNC:12652|Ensembl:ENSG00000125753|HPRD:03415|Vega:OTTHUMG00000182124 |
| Gene type | protein-coding |
| Map location | 19q13.32 |
| Pascal p-value | 0.438 |
| Sherlock p-value | 0.101 |
| Fetal beta | -0.322 |
| eGene | Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10979666 | chr9 | 111800878 | VASP | 7408 | 0.11 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003779 | actin binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0017124 | SH3 domain binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
| GO:0001843 | neural tube closure | IEA | - | |
| GO:0030036 | actin cytoskeleton organization | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030175 | filopodium | IEA | axon (GO term level: 5) | - |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0030027 | lamellipodium | IEA | - | |
| GO:0005925 | focal adhesion | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0015629 | actin cytoskeleton | TAS | 7828592 | |
| GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| APBB1IP | INAG1 | PREL1 | RARP1 | RIAM | amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein | - | HPRD | 15469846 |15642358 |
| APBB1IP | INAG1 | PREL1 | RARP1 | RIAM | amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein | RIAM interacts with VASP. | BIND | 15469846 |
| DMRTB1 | - | DMRT-like family B with proline-rich C-terminal, 1 | Two-hybrid | BioGRID | 16189514 |
| DNMBP | KIAA1010 | TUBA | dynamin binding protein | Reconstituted Complex | BioGRID | 14506234 |
| ERMAP | MGC118810 | MGC118811 | MGC118812 | MGC118813 | PRO2801 | RD | SC | erythroblast membrane-associated protein (Scianna blood group) | - | HPRD | 15469845 |
| FYB | ADAP | PRO0823 | SLAP-130 | FYN binding protein (FYB-120/130) | - | HPRD,BioGRID | 10747096 |
| GSN | DKFZp313L0718 | gelsolin (amyloidosis, Finnish type) | - | HPRD | 11093254 |
| LPP | - | LIM domain containing preferred translocation partner in lipoma | - | HPRD | 10637295 |
| NOL3 | ARC | CARD2 | MYC | MYP | NOP | NOP30 | nucleolar protein 3 (apoptosis repressor with CARD domain) | Two-hybrid | BioGRID | 16189514 |
| PFN1 | - | profilin 1 | - | HPRD,BioGRID | 10882740 |
| PFN2 | D3S1319E | PFL | profilin 2 | - | HPRD,BioGRID | 7737110 |10882740 |
| PLSCR1 | MMTRA1B | phospholipid scramblase 1 | Two-hybrid | BioGRID | 16189514 |
| RAPH1 | ALS2CR18 | ALS2CR9 | KIAA1681 | LPD | PREL2 | RMO1 | RalGDS/AF-6 | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 | Reconstituted Complex | BioGRID | 15469845 |
| TES | DKFZp586B2022 | MGC1146 | TESS | TESS-2 | testis derived transcript (3 LIM domains) | Affinity Capture-Western Reconstituted Complex | BioGRID | 12695497 |
| TES | DKFZp586B2022 | MGC1146 | TESS | TESS-2 | testis derived transcript (3 LIM domains) | TES interacts with VASP. | BIND | 12571287 |
| TRIM9 | KIAA0282 | RNF91 | SPRING | tripartite motif-containing 9 | Two-hybrid | BioGRID | 16189514 |
| VASP | - | vasodilator-stimulated phosphoprotein | - | HPRD,BioGRID | 12220179 |
| VCL | CMD1W | MVCL | vinculin | - | HPRD,BioGRID | 10882740 |
| WAS | IMD2 | THC | WASP | Wiskott-Aldrich syndrome (eczema-thrombocytopenia) | - | HPRD,BioGRID | 11598004 |
| WWP2 | AIP2 | WWp2-like | WW domain containing E3 ubiquitin protein ligase 2 | Two-hybrid | BioGRID | 16189514 |
| XPO6 | EXP6 | FLJ22519 | KIAA0370 | RANBP20 | exportin 6 | - | HPRD,BioGRID | 14592989 |
| ZYX | ESP-2 | HED-2 | zyxin | - | HPRD | 7644520 |10801818 |10851246 |10882740 |
| ZYX | ESP-2 | HED-2 | zyxin | Affinity Capture-Western in vitro in vivo Two-hybrid | BioGRID | 10801818 |10882740 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
| KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS | 97 | 71 | All SZGR 2.0 genes in this pathway |
| KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION | 118 | 78 | All SZGR 2.0 genes in this pathway |
| SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES | 35 | 25 | All SZGR 2.0 genes in this pathway |
| ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
| PID ECADHERIN KERATINOCYTE PATHWAY | 21 | 19 | All SZGR 2.0 genes in this pathway |
| PID IL8 CXCR2 PATHWAY | 34 | 26 | All SZGR 2.0 genes in this pathway |
| PID ECADHERIN STABILIZATION PATHWAY | 42 | 34 | All SZGR 2.0 genes in this pathway |
| PID THROMBIN PAR1 PATHWAY | 43 | 32 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
| REACTOME TCR SIGNALING | 54 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME GENERATION OF SECOND MESSENGER MOLECULES | 27 | 25 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ROBO RECEPTOR | 30 | 26 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL EXTRACELLULAR MATRIX INTERACTIONS | 14 | 10 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL JUNCTION ORGANIZATION | 78 | 43 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| RODRIGUES NTN1 TARGETS DN | 158 | 102 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL DN | 186 | 107 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
| CHANG POU5F1 TARGETS UP | 15 | 10 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| MA MYELOID DIFFERENTIATION UP | 39 | 29 | All SZGR 2.0 genes in this pathway |
| YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE BY UV | 62 | 43 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
| MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
| SWEET KRAS ONCOGENIC SIGNATURE | 89 | 56 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-17-5p/20/93.mr/106/519.d | 335 | 341 | 1A | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-204/211 | 412 | 419 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
| miR-214 | 180 | 186 | 1A | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| miR-22 | 499 | 506 | 1A,m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.