Gene Page: EZR

Summary
GeneID  7430
Symbol  EZR
Synonyms  CVIL|CVL|DKFZp762H157|FLJ26216|MGC1584|VIL2
Description  ezrin
See related  HGNC:12691|MIM:123900|Ensembl:ENSG00000092820|HPRD:00475|
Locus tag  -
Gene type  protein-coding
Map location  6q25.2-q26
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.46 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
ALOXE30.810.86
NTNG10.790.36
RGS80.770.67
CHRNA40.770.79
RGS30.760.32
KCND20.760.70
ZDHHC220.760.61
SAMD50.760.68
GRIN2D0.750.77
TCF7L20.750.21
Top 10 negatively co-expressed genes
CXCL14-0.37-0.64
AF347015.31-0.36-0.72
AF347015.2-0.35-0.69
OAF-0.35-0.67
CLDN10-0.34-0.64
COX4I2-0.34-0.66
COPZ2-0.34-0.65
AF347015.8-0.34-0.71
AC021016.1-0.33-0.69
RLBP1-0.33-0.66
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005198structural molecule activityIEA-
GO:0008092cytoskeletal protein bindingIEA-
GO:0051015actin filament bindingIDA10793131 
GO:0043621protein self-associationIPI7844168 
GO:0050839cell adhesion molecule bindingIPI12082081 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0022614membrane to membrane dockingIEP12082081 
GO:0008360regulation of cell shapeIEA-
GO:0007016cytoskeletal anchoring at plasma membraneNAS10793131 
GO:0007159leukocyte adhesionIEP12082081 
GO:0051017actin filament bundle formationIDA10793131 
GO:0035088establishment or maintenance of apical/basal cell polarityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0030175filopodiumIDAaxon (GO term level: 5)12082081 
GO:0001931uropodIEASynap (GO term level: 5)-
GO:0001726ruffleIDA9852149 
GO:0005829cytosolIDA9852149 
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIEA-
GO:0005932basal bodyIEA-
GO:0005902microvillusNAS10793131 
GO:0005884actin filamentIDA11598191 
GO:0005886plasma membraneIEA-
GO:0016324apical plasma membraneIEA-
GO:0019898extrinsic to membraneIDA7844168 
GO:0019898extrinsic to membraneIEA-
GO:0030863cortical cytoskeletonTAS11598191 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTBPS1TP5BP1actin, beta-HPRD7876308 
ACTC1ACTC | CMD1R | CMH11actin, alpha, cardiac muscle 1-HPRD12271120 
ADORA2BADORA2adenosine A2b receptor-HPRD,BioGRID12080047 
AHNAKAHNAKRS | MGC5395AHNAK nucleoproteinAffinity Capture-MSBioGRID14625392 
ARHGDIAGDIA1 | MGC117248 | RHOGDI | RHOGDI-1Rho GDP dissociation inhibitor (GDI) alphaCo-purificationBioGRID15659383 
ARHGDIBD4 | GDIA2 | GDID4 | LYGDI | Ly-GDI | RAP1GN1 | RhoGDI2Rho GDP dissociation inhibitor (GDI) beta-HPRD9287351 
BIDFP497 | MGC15319 | MGC42355BH3 interacting domain death agonistCo-purificationBioGRID15659383 
C9orf127MGC120460 | NAG-5 | NGX6 | RP11-112J3.10chromosome 9 open reading frame 127-HPRD15498789 
CASP10ALPS2 | FLICE2 | MCH4caspase 10, apoptosis-related cysteine peptidaseCo-purificationBioGRID15659383 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidaseCo-purificationBioGRID15659383 
CD44CDW44 | CSPG8 | ECMR-III | HCELL | IN | LHR | MC56 | MDU2 | MDU3 | MGC10468 | MIC4 | MUTCH-I | Pgp1CD44 molecule (Indian blood group)-HPRD,BioGRID12032545 |12370738 
CDH1Arc-1 | CD324 | CDHE | ECAD | LCAM | UVOcadherin 1, type 1, E-cadherin (epithelial)-HPRD,BioGRID10462524 
CFTRABC35 | ABCC7 | CF | CFTR/MRP | MRP7 | TNR-CFTR | dJ760C5.1cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)-HPRD,BioGRID10893422 
CLIC5CLIC5B | FLJ90663 | MST130 | MSTP130 | dJ447E21.4chloride intracellular channel 5-HPRD,BioGRID10793131 
CTNNB1CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923catenin (cadherin-associated protein), beta 1, 88kDa-HPRD,BioGRID10462524 
DLG1DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlgdiscs, large homolog 1 (Drosophila)-HPRD,BioGRID11726633 
EZRCVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2ezrin-HPRD,BioGRID9501018 
FADDGIG3 | MGC8528 | MORT1Fas (TNFRSF6)-associated via death domainCo-purificationBioGRID15659383 
FASALPS1A | APO-1 | APT1 | CD95 | FAS1 | FASTM | TNFRSF6Fas (TNF receptor superfamily, member 6)Co-purificationBioGRID15659383 
FASLGAPT1LG1 | CD178 | CD95L | FASL | TNFSF6Fas ligand (TNF superfamily, member 6)-HPRD,BioGRID11013215 
GABARAPL2ATG8 | GATE-16 | GATE16 | GEF-2 | GEF2GABA(A) receptor-associated protein-like 2Affinity Capture-MSBioGRID17353931 
HLA-BAS | HLA-B-7301 | HLA-B73 | HLAB | HLAC | SPDA1major histocompatibility complex, class I, BAffinity Capture-MSBioGRID17353931 
ICAM1BB2 | CD54 | P3.58intercellular adhesion molecule 1-HPRD,BioGRID9705328 
ICAM2CD102intercellular adhesion molecule 2Affinity Capture-Western
Reconstituted Complex		BioGRID9705328 
ICAM3CD50 | CDW50 | ICAM-Rintercellular adhesion molecule 3-HPRD,BioGRID11784723 
IQGAP1HUMORFA01 | KIAA0051 | SAR1 | p195IQ motif containing GTPase activating protein 1Reconstituted ComplexBioGRID10793131 
L1CAMCAML1 | CD171 | HSAS | HSAS1 | MASA | MIC5 | N-CAML1 | S10 | SPG1L1 cell adhesion molecule-HPRD,BioGRID12070130 
MAPK8JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1mitogen-activated protein kinase 8Co-purificationBioGRID15659383 
MCCDKFZp762O1615 | FLJ38893 | FLJ46755 | MCC1mutated in colorectal cancersAffinity Capture-MSBioGRID17353931 
MSN-moesin-HPRD,BioGRID7579708 |8248180 
NF2ACN | BANF | SCHneurofibromin 2 (merlin)merlin interacts with ezrin.BIND10036239 
-HPRD,BioGRID10036239 
PALLDCGI-151 | FLJ22190 | FLJ38193 | FLJ39139 | KIAA0992 | PNCA1 | SIH002palladin, cytoskeletal associated protein-HPRD11598191 
-HPRD,BioGRID1159819 
PIK3R1GRB1 | p85 | p85-ALPHAphosphoinositide-3-kinase, regulatory subunit 1 (alpha)-HPRD,BioGRID10377409 
PPLKIAA0568 | MGC134872periplakinAffinity Capture-MSBioGRID14625392 
PRKAB1AMPK | HAMPKb | MGC17785protein kinase, AMP-activated, beta 1 non-catalytic subunitAffinity Capture-MSBioGRID17353931 
PRKAR2AMGC3606 | PKR2 | PRKAR2protein kinase, cAMP-dependent, regulatory, type II, alphaPKA II interacts with Ezrin.BIND9009265 |10799517 
|12080047 
PRKCAAAG6 | MGC129900 | MGC129901 | PKC-alpha | PKCA | PRKACAprotein kinase C, alpha-HPRD,BioGRID11387207 
PRXCMT4F | KIAA1620periaxinAffinity Capture-MSBioGRID14625392 
PTK2FADK | FAK | FAK1 | pp125FAKPTK2 protein tyrosine kinase 2-HPRD,BioGRID11468295 
RDXDFNB24radixin-HPRD9501018 
RHOAARH12 | ARHA | RHO12 | RHOH12ras homolog gene family, member ACo-purificationBioGRID15659383 
S100PMIG9S100 calcium binding protein P-HPRD,BioGRID12808036 
SCYL3PACE-1 | PACE1 | RP1-97P20.2SCY1-like 3 (S. cerevisiae)-HPRD,BioGRID12651155 
SDC2HSPG | HSPG1 | SYND2syndecan 2-HPRD,BioGRID10704377 
SELLCD62L | LAM-1 | LAM1 | LECAM1 | LNHR | LSEL | LYAM1 | Leu-8 | Lyam-1 | PLNHR | TQ1 | hLHRcselectin L-HPRD,BioGRID11706008 
SELPCD62 | CD62P | FLJ45155 | GMP140 | GRMP | LECAM3 | PADGEM | PSELselectin P (granule membrane protein 140kDa, antigen CD62)-HPRD,BioGRID10733515 
SLC9A3R1EBP50 | NHERF | NHERF1 | NPHLOP2solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1-HPRD,BioGRID9314537 
SLC9A3R2E3KARP | MGC104639 | NHE3RF2 | NHERF-2 | NHERF2 | OCTS2 | SIP-1 | SIP1 | TKA-1solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2-HPRD,BioGRID9748260 |12080047 
SPNCD43 | GPL115 | LSNsialophorin-HPRD,BioGRID9616160 
SPTA1EL2 | SPTAspectrin, alpha, erythrocytic 1 (elliptocytosis 2)Affinity Capture-MSBioGRID14625392 
SYKDKFZp313N1010 | FLJ25043 | FLJ37489spleen tyrosine kinaseSyk interacts with ezrin. This interaction was modeled on a demonstrated interaction between Syk and ezrin from unspecified species.BIND12387735 
TBC1D10AEPI64 | TBC1D10 | dJ130H16.1 | dJ130H16.2TBC1 domain family, member 10A-HPRD11285285 
TNFRSF10BCD262 | DR5 | KILLER | KILLER/DR5 | TRAIL-R2 | TRAILR2 | TRICK2 | TRICK2A | TRICK2B | TRICKB | ZTNFR9tumor necrosis factor receptor superfamily, member 10bCo-purificationBioGRID15659383 
TNFRSF1ACD120a | FPF | MGC19588 | TBP1 | TNF-R | TNF-R-I | TNF-R55 | TNFAR | TNFR1 | TNFR55 | TNFR60 | p55 | p55-R | p60tumor necrosis factor receptor superfamily, member 1ACo-purificationBioGRID15659383 
TSC1KIAA0243 | LAM | MGC86987 | TSCtuberous sclerosis 1Hamartin interacts with ezrin.BIND10806479 
-HPRD,BioGRID10806479 
VCAM1CD106 | DKFZp779G2333 | INCAM-100 | MGC99561vascular cell adhesion molecule 1-HPRD,BioGRID12082081 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1833663731A,m8hsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-204/2117177241A,m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-4106756811Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-4957427481Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-96191197m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.