Gene Page: MPPED2
Summary ?
GeneID | 744 |
Symbol | MPPED2 |
Synonyms | 239FB|C11orf8 |
Description | metallophosphoesterase domain containing 2 |
Reference | MIM:600911|HGNC:HGNC:1180|Ensembl:ENSG00000066382|HPRD:02947|Vega:OTTHUMG00000166159 |
Gene type | protein-coding |
Map location | 11p13 |
Pascal p-value | 5.318E-5 |
Sherlock p-value | 0.615 |
Fetal beta | 1.753 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg17320698 | 11 | 30510489 | MPPED2 | 2.58E-4 | 0.529 | 0.038 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12367145 | chr12 | 95300075 | MPPED2 | 744 | 0.14 | trans | ||
rs7306940 | chr12 | 95308092 | MPPED2 | 744 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016787 | hydrolase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 7527372 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL UP | 94 | 59 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
GRABARCZYK BCL11B TARGETS DN | 57 | 35 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL DN | 118 | 79 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
FRASOR RESPONSE TO ESTRADIOL UP | 37 | 28 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD DN | 150 | 93 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER DN | 134 | 83 | All SZGR 2.0 genes in this pathway |
SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION DN | 20 | 12 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 1HR DN | 222 | 147 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS NOT VIA AKT1 UP | 211 | 131 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
PLASARI NFIC TARGETS BASAL UP | 27 | 17 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 1039 | 1045 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-130/301 | 1036 | 1042 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-142-5p | 1211 | 1217 | 1A | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-148/152 | 1037 | 1043 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-153 | 1216 | 1222 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-19 | 376 | 383 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA | ||||
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-218 | 1065 | 1071 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-23 | 21 | 27 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-320 | 656 | 663 | 1A,m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-323 | 21 | 27 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-34/449 | 42 | 48 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-374 | 57 | 63 | 1A | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-384 | 1159 | 1165 | 1A | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
miR-410 | 747 | 753 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-448 | 1215 | 1222 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-495 | 634 | 640 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU | ||||
miR-499 | 301 | 307 | m8 | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.