Gene Page: RNF103
Summary ?
GeneID | 7844 |
Symbol | RNF103 |
Synonyms | HKF-1|KF-1|KF1|ZFP-103|ZFP103 |
Description | ring finger protein 103 |
Reference | MIM:602507|HGNC:HGNC:12859|Ensembl:ENSG00000239305|HPRD:03939|Vega:OTTHUMG00000153197 |
Gene type | protein-coding |
Map location | 2p11.2 |
Pascal p-value | 0.092 |
Sherlock p-value | 0.551 |
DEG p-value | DEG:Zhao_2015:p=2.57e-04:q=0.0872 |
Fetal beta | -0.459 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0004 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg07322981 | 2 | 86850757 | RNF103 | -0.032 | 0.34 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007417 | central nervous system development | TAS | Brain (GO term level: 6) | 9070305 |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN | 136 | 86 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
MISSIAGLIA REGULATED BY METHYLATION UP | 126 | 78 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION L0 L1 UP | 17 | 12 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION L1 G1 DN | 12 | 6 | All SZGR 2.0 genes in this pathway |
DORSAM HOXA9 TARGETS UP | 35 | 25 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON UP | 77 | 47 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-134 | 60 | 66 | 1A | hsa-miR-134brain | UGUGACUGGUUGACCAGAGGG |
miR-21 | 21 | 27 | m8 | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
miR-218 | 242 | 249 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-324-3p | 103 | 109 | 1A | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
miR-330 | 25 | 31 | 1A | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-543 | 54 | 60 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.