Gene Page: PAX8

Summary
GeneID  7849
Symbol  PAX8
Synonyms  -
Description  paired box 8
See related  HGNC:8622|MIM:167415|Ensembl:ENSG00000125618|HPRD:01335|
Locus tag  -
Gene type  protein-coding
Map location  2q12-q14
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00755 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004996thyroid-stimulating hormone receptor activityTAS9590296 
GO:0003700transcription factor activityTAS10377248 
GO:0005515protein bindingISS-
GO:0016563transcription activator activityISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001656metanephros developmentIEA-
GO:0009653anatomical structure morphogenesisTAS9590296 
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
GO:0030878thyroid gland developmentIEA-
GO:0045893positive regulation of transcription, DNA-dependentISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005654nucleoplasmISS-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NKX2-1BCH | BHC | NK-2 | NKX2.1 | NKX2A | TEBP | TITF1 | TTF-1 | TTF1NK2 homeobox 1-HPRD,BioGRID12441357 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-13465711Ahsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-1401031091Ahsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-299-5p115511611Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-32658651A,m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.