Gene Page: ATG9A
Summary ?
GeneID | 79065 |
Symbol | ATG9A |
Synonyms | APG9L1|MGD3208|mATG9 |
Description | autophagy related 9A |
Reference | MIM:612204|HGNC:HGNC:22408|Ensembl:ENSG00000198925|HPRD:07979|Vega:OTTHUMG00000154557 |
Gene type | protein-coding |
Map location | 2q35 |
Pascal p-value | 2.321E-5 |
Sherlock p-value | 4.203E-5 |
Fetal beta | -0.067 |
eGene | Cerebellum Myers' cis & trans |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4425711 | chr7 | 54637269 | ATG9A | 79065 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
VPS35 | 0.87 | 0.85 |
MUDENG | 0.87 | 0.85 |
HIAT1 | 0.86 | 0.84 |
SLC30A9 | 0.86 | 0.84 |
NIPA2 | 0.85 | 0.82 |
PIAS2 | 0.85 | 0.83 |
YIPF5 | 0.85 | 0.84 |
KIAA1715 | 0.85 | 0.86 |
AKAP10 | 0.85 | 0.86 |
PSMD5 | 0.85 | 0.82 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.69 | -0.62 |
AF347015.8 | -0.69 | -0.62 |
AF347015.21 | -0.69 | -0.59 |
MT-CYB | -0.67 | -0.60 |
AF347015.2 | -0.66 | -0.57 |
AF347015.31 | -0.66 | -0.60 |
AF347015.33 | -0.65 | -0.58 |
AF347015.26 | -0.65 | -0.57 |
AF347015.15 | -0.65 | -0.59 |
AF347015.18 | -0.64 | -0.62 |
Section III. Gene Ontology annotation
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000045 | autophagic vacuole formation | IMP | 15755735 | |
GO:0006914 | autophagy | IEA | - | |
GO:0015031 | protein transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005776 | autophagic vacuole | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
LINSLEY MIR16 TARGETS | 206 | 127 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
MIZUSHIMA AUTOPHAGOSOME FORMATION | 19 | 15 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-28 | 925 | 931 | 1A | hsa-miR-28brain | AAGGAGCUCACAGUCUAUUGAG |
miR-29 | 251 | 258 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-338 | 914 | 920 | m8 | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-34/449 | 286 | 292 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-96 | 362 | 368 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.